Frequenin (NCS1) (NM_001128826) Human Untagged Clone
CAT#: SC322865
NCS1 (untagged)-Human neuronal calcium sensor 1 (NCS1), transcript variant 2
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | FLUP; FREQ |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC322865 representing NM_001128826.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCAACGATTACCGAGAAGGAGGTCCAGCAGTGGTACAAAGGCTTCATCAAGGACTGCCCCAGTGGG CAGCTGGATGCGGCAGGCTTCCAGAAGATCTACAAGCAATTCTTCCCGTTCGGAGACCCCACCAAGTTT GCCACATTTGTTTTCAACGTCTTTGATGAAAACAAGGACGGGCGAATTGAGTTCTCCGAGTTCATCCAG GCGCTGTCGGTGACCTCACGGGGAACCCTGGATGAGAAGCTACGGTGGGCCTTCAAGCTCTACGACTTG GACAATGATGGCTACATCACCAGGAATGAGATGCTGGACATTGTGGATGCCATTTACCAGATGGTGGGG AATACCGTGGAGCTCCCAGAGGAGGAGAACACTCCTGAGAAGAGGGTGGACCGGATCTTTGCCATGATG GATAAGAATGCCGACGGGAAGCTGACCCTGCAGGAGTTCCAGGAGGGTTCCAAGGCAGACCCGTCCATT GTGCAGGCGCTGTCCCTCTACGACGGGCTGGTATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001128826 |
| Insert Size | 519 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001128826.1 |
| RefSeq Size | 4878 bp |
| RefSeq ORF | 519 bp |
| Locus ID | 23413 |
| UniProt ID | P62166 |
| Protein Families | Druggable Genome |
| MW | 19.7 kDa |
| Gene Summary | This gene is a member of the neuronal calcium sensor gene family, which encode calcium-binding proteins expressed predominantly in neurons. The protein encoded by this gene regulates G protein-coupled receptor phosphorylation in a calcium-dependent manner and can substitute for calmodulin. The protein is associated with secretory granules and modulates synaptic transmission and synaptic plasticity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) contains a distinct 5' UTR and 5' coding region, compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus when compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225173 | NCS1 (Myc-DDK-tagged)-Human neuronal calcium sensor 1 (NCS1), transcript variant 2 |
CNY 2400.00 |
|
| RC225173L3 | Lenti ORF clone of Human neuronal calcium sensor 1 (NCS1), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC225173L4 | Lenti ORF clone of Human neuronal calcium sensor 1 (NCS1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG225173 | NCS1 (tGFP-tagged) - Human neuronal calcium sensor 1 (NCS1), transcript variant 2 |
CNY 4370.00 |
其它Frequenin产品
