KCTD6 (NM_001128214) Human Untagged Clone
CAT#: SC322912
KCTD6 (untagged)-Human potassium channel tetramerisation domain containing 6 (KCTD6), transcript variant 2
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | KCASH3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC322912 representing NM_001128214.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGATAATGGAGACTGGGGCTATATGATGACTGACCCAGTCACATTAAATGTAGGTGGACACTTGTAT ACAACGTCTCTCACCACATTGACGCGTTACCCGGATTCCATGCTTGGAGCTATGTTTGGGGGGGACTTC CCCACAGCTCGAGACCCTCAAGGCAATTACTTTATTGATCGAGATGGACCTCTTTTCCGATATGTCCTC AACTTCTTAAGAACTTCAGAATTGACCTTACCGTTGGATTTTAAGGAATTTGATCTGCTTCGGAAAGAA GCAGATTTTTACCAGATTGAGCCCTTGATTCAGTGTCTCAATGATCCTAAGCCTTTGTATCCCATGGAT ACTTTTGAAGAAGTTGTGGAGCTGTCTAGTACTCGGAAGCTTTCTAAGTACTCCAACCCAGTGGCTGTC ATCATAACGCAACTAACCATCACCACTAAGGTCCATTCCTTACTAGAAGGCATCTCAAATTATTTTACC AAGTGGAATAAGCACATGATGGACACCAGAGACTGCCAGGTTTCCTTTACTTTTGGACCCTGTGATTAT CACCAGGAAGTTTCTCTTAGGGTCCACCTGATGGAATACATTACAAAACAAGGTTTCACGATCCGCAAC ACCCGGGTGCATCACATGAGTGAGCGGGCCAATGAAAACACAGTGGAGCACAACTGGACTTTCTGTAGG CTAGCCCGGAAGACAGACGACTGA AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT ATCCTGGATTACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-RsrII |
ACCN | NM_001128214 |
Insert Size | 714 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001128214.1 |
RefSeq Size | 1566 bp |
RefSeq ORF | 714 bp |
Locus ID | 200845 |
UniProt ID | Q8NC69 |
Protein Families | Ion Channels: Other |
MW | 27.6 kDa |
Gene Summary | Probable substrate-specific adapter of a BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex mediating the ubiquitination and subsequent proteasomal degradation of target proteins. Promotes the ubiquitination of HDAC1; the function seems to depend on KCTD11:KCTD6 oligomerization. Can function as antagonist of the Hedgehog pathway by affecting the nuclear transfer of transcription factor GLI1; the function probably occurs via HDAC1 down-regulation, keeping GLI1 acetylated and inactive. Inhibits cell growth and tumorigenicity of medulloblastoma (MDB) (PubMed:21472142). Involved in regulating protein levels of ANK1 isoform Mu17 probably implicating CUL3-dependent proteasomal degradation (PubMed:22573887).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225297 | KCTD6 (Myc-DDK-tagged)-Human potassium channel tetramerisation domain containing 6 (KCTD6), transcript variant 2 |
CNY 2400.00 |
|
RC225297L3 | Lenti ORF clone of Human potassium channel tetramerisation domain containing 6 (KCTD6), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC225297L4 | Lenti ORF clone of Human potassium channel tetramerisation domain containing 6 (KCTD6), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG225297 | KCTD6 (tGFP-tagged) - Human potassium channel tetramerisation domain containing 6 (KCTD6), transcript variant 2 |
CNY 4370.00 |