CADM3 (NM_001127173) Human Untagged Clone
CAT#: SC323023
CADM3 (untagged)-Human cell adhesion molecule 3 (CADM3), transcript variant 2
CNY 3656.00
CNY 7220.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BIgR; IGSF4B; Necl-1; NECL1; synCAM3; TSLL1 |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001127173 edited
ATGGGGGCCCCAGCCGCCTCGCTCCTGCTCCTGCTCCTGCTGTTCGCCTGCTGCTGGGCG CCCGGCGGGGCCAACCTCTCCCAGGACGACAGCCAGCCCTGGACATCTGATGAAACAGTG GTGGCTGGTGGCACCGTGGTGCTCAAGTGCCAAGTGAAAGATCACGAGGACTCATCCCTG CAATGGTCTAACCCTGCTCAGCAGACTCTCTACTTTGGGGAGAAGAGAGCCCTTCGAGAT AATCGAATTCAGCTGGTTACCTCTACGCCCCACGAGCTCAGCATCAGCATCAGCAATGTG GCCCTGGCAGACGAGGGCGAGTACACCTGCTCAATCTTCACTATGCCTGTGCGAACTGCC AAGTCCCTCGTCACTGTGCTAGGAATTCCACAGAAGCCCATCATCACTGGTTATAAATCT TCATTACGGGAAAAAGACACAGCCACCCTAAACTGTCAGTCTTCTGGGAGCAAGCCTGCA GCCCGGCTCACCTGGAGAAAGGGTGACCAAGAACTCCACGGAGAACCAACCCGCATACAG GAAGATCCCAATGGTAAAACCTTCACTGTCAGCAGCTCGGTGACATTCCAGGTTACCCGG GAGGATGATGGGGCGAGCATCGTGTGCTCTGTGAACCATGAATCTCTAAAGGGAGCTGAC AGATCCACCTCTCAACGCATTGAAGTTTTATACACACCAACTGCGATGATTAGGCCAGAC CCTCCCCATCCTCGTGAGGGCCAGAAGCTGTTGCTACACTGTGAGGGTCGCGGCAATCCA GTCCCCCAGCAGTACCTATGGGAGAAGGAGGGCAGTGTGCCACCCCTGAAGATGACCCAG GAGAGTGCCCTGATCTTCCCTTTCCTCAACAAGAGTGACAGTGGCACCTACGGCTGCACA GCCACCAGCAACATGGGCAGCTACAAGGCCTACTACACCCTCAATGTTAATGACCCCAGT CCGGTGCCCTCCTCCTCCAGCACCTACCACGCCATCATCGGTGGGATCGTGGCTTTCATT GTCTTCCTGCTGCTCATCATGCTCATCTTCCTTGGCCACTACTTGATCCGGCACAAAGGA ACCTACCTGACACATGAGGCAAAAGGCTCCGACGATGCTCCAGACGCGGACACGGCCATC ATCAATGCAGAAGGCGGGCAGTCAGGAGGGGACGACAAGAAGGAATATTTCATCTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001127173 |
| Insert Size | 4700 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001127173.1, NP_001120645.1 |
| RefSeq Size | 3559 bp |
| RefSeq ORF | 1197 bp |
| Locus ID | 57863 |
| UniProt ID | Q8N126 |
| Protein Families | Transmembrane |
| Protein Pathways | Cell adhesion molecules (CAMs) |
| Gene Summary | The protein encoded by this gene is a calcium-independent cell-cell adhesion protein that can form homodimers or heterodimers with other nectin proteins. The encoded protein has both homophilic and heterophilic cell-cell adhesion activity. This gene is reported to be a tumor suppressor gene. [provided by RefSeq, Oct 2016] Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225621 | CADM3 (Myc-DDK-tagged)-Human cell adhesion molecule 3 (CADM3), transcript variant 2 |
CNY 3990.00 |
|
| RC225621L3 | Lenti-ORF clone of CADM3 (Myc-DDK-tagged)-Human cell adhesion molecule 3 (CADM3), transcript variant 2 |
CNY 5890.00 |
|
| RC225621L4 | Lenti-ORF clone of CADM3 (mGFP-tagged)-Human cell adhesion molecule 3 (CADM3), transcript variant 2 |
CNY 5890.00 |
|
| RG225621 | CADM3 (tGFP-tagged) - Human cell adhesion molecule 3 (CADM3), transcript variant 2 |
CNY 4370.00 |
