Brk (PTK6) (NM_005975) Human Untagged Clone
CAT#: SC323343
PTK6 (untagged)-Kinase deficient mutant (K219M) of Human PTK6 protein tyrosine kinase 6 (PTK6)
CNY 5,488.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BRK |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>SC323343 representing NM_005975.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGTGTCCCGGGACCAGGCTCACCTGGGCCCCAAGTATGTGGGCCTCTGGGACTTCAAGTCCCGGACG GACGAGGAGCTGAGCTTCCGCGCGGGGGACGTCTTCCACGTGGCCAGGAAGGAGGAGCAGTGGTGGTGG GCCACGCTGCTGGACGAGGCGGGTGGGGCCGTGGCCCAGGGCTATGTGCCCCACAACTACCTGGCCGAG AGGGAGACGGTGGAGTCGGAACCGTGGTTCTTTGGCTGCATCTCCCGCTCGGAAGCTGTGCGTCGGCTG CAGGCCGAGGGCAACGCCACGGGCGCCTTCCTGATCAGGGTCAGCGAGAAGCCGAGTGCCGACTACGTC CTGTCGGTGCGGGACACGCAGGCTGTGCGGCACTACAAGATCTGGCGGCGTGCCGGGGGCCGGCTGCAC CTGAACGAGGCGGTGTCCTTCCTCAGCCTGCCCGAGCTTGTGAACTACCACAGGGCCCAGAGCCTGTCC CACGGCCTGCGGCTGGCCGCGCCCTGCCGGAAGCACGAGCCTGAGCCCCTGCCCCATTGGGATGACTGG GAGAGGCCGAGGGAGGAGTTCACGCTCTGCAGGAAGCTGGGGTCCGGCTACTTTGGGGAGGTCTTCGAG GGGCTCTGGAAAGACCGGGTCCAGGTGGCCATTAAGGTGATTTCTCGAGACAACCTCCTGCACCAGCAG ATGCTGCAGTCGGAGATCCAGGCCATGAAGAAGCTGCGGCACAAACACATCCTGGCGCTGTACGCCGTG GTGTCCGTGGGGGACCCCGTGTACATCATCACGGAGCTCATGGCCAAGGGCAGCCTGCTGGAGCTGCTC CGCGACTCTGATGAGAAAGTCCTGCCCGTTTCGGAGCTGCTGGACATCGCCTGGCAGGTGGCTGAGGGC ATGTGTTACCTGGAGTCGCAGAATTACATCCACCGGGACCTGGCCGCCAGGAACATCCTCGTCGGGGAA AACACCCTCTGCAAAGTTGGGGACTTCGGGTTAGCCAGGCTTATCAAGGAGGACGTCTACCTCTCCCAT GACCACAATATCCCCTACAAGTGGACGGCCCCTGAAGCGCTCTCCCGAGGCCATTACTCCACCAAATCC GACGTCTGGTCCTTTGGGATTCTCCTGCATGAGATGTTCAGCAGGGGTCAGGTGCCCTACCCAGGCATG TCCAACCATGAGGCCTTCCTGAGGGTGGACGCCGGCTACCGCATGCCCTGCCCTCTGGAGTGCCCGCCC AGCGTGCACAAGCTGATGCTGACATGCTGGTGCAGGGACCCCGAGCAGAGACCCTGCTTCAAGGCCCTG CGGGAGAGGCTCTCCAGCTTCACCAGCTACGAGAACCCGACCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_005975 |
Insert Size | 1356 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This kinase-deficient mutant clone was generated by created by site-directed mutagenesis from the corresponding wild-type clone. See details in "Application of active and kinase-deficient kinome collection for identification of kinases regulating hedgehog signaling." Cell. 2008 May p536-548. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_005975.2 |
RefSeq Size | 2519 bp |
RefSeq ORF | 1356 bp |
Locus ID | 5753 |
UniProt ID | Q13882 |
Protein Families | Druggable Genome, Protein Kinase, Secreted Protein |
MW | 51.8 kDa |
Gene Summary | The protein encoded by this gene is a cytoplasmic nonreceptor protein kinase which may function as an intracellular signal transducer in epithelial tissues. Overexpression of this gene in mammary epithelial cells leads to sensitization of the cells to epidermal growth factor and results in a partially transformed phenotype. Expression of this gene has been detected at low levels in some breast tumors but not in normal breast tissue. The encoded protein has been shown to undergo autophosphorylation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC207766 | PTK6 (Myc-DDK-tagged)-Human PTK6 protein tyrosine kinase 6 (PTK6) |
CNY 5,488.00 |
|
RC207766L1 | Lenti ORF clone of Human PTK6 protein tyrosine kinase 6 (PTK6), Myc-DDK-tagged |
CNY 7,888.00 |
|
RC207766L2 | Lenti ORF clone of Human PTK6 protein tyrosine kinase 6 (PTK6), mGFP tagged |
CNY 7,888.00 |
|
RC207766L3 | Lenti ORF clone of Human PTK6 protein tyrosine kinase 6 (PTK6), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC207766L4 | Lenti ORF clone of Human PTK6 protein tyrosine kinase 6 (PTK6), mGFP tagged |
CNY 7,888.00 |
|
RG207766 | PTK6 (tGFP-tagged) - Human PTK6 protein tyrosine kinase 6 (PTK6) |
CNY 7,088.00 |
|
SC124087 | PTK6 (untagged)-Human PTK6 protein tyrosine kinase 6 (PTK6) |
CNY 5,488.00 |