CDK4 (NM_000075) Human Untagged Clone

CAT#: SC323460

CDK4 (untagged)-Kinase deficient mutant (K35M) of Human cyclin-dependent kinase 4 (CDK4)



  "NM_000075" in other vectors (9)

CNY 3600.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
Rabbit polyclonal CDK4 Antibody (C-term)
    • 400 ul

CNY 6314.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CMM3; PSK-J3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_000075, the custom clone sequence may differ by one or more nucleotides


ATGGCTACCTCTCGATATGAGCCAGTGGCTGAAATTGGTGTCGGTGCCTATGGGACAGTGTACAAGGCCC
GTGATCCCCACAGTGGCCACTTTGTGGCCCTCAAGAGTGTGAGAGTCCCCAATGGAGGAGGAGGTGGAGG
AGGCCTTCCCATCAGCACAGTTCGTGAGGTGGCTTTACTGAGGCGACTGGAGGCTTTTGAGCATCCCAAT
GTTGTCCGGCTGATGGACGTCTGTGCCACATCCCGAACTGACCGGGAGATCAAGGTAACCCTGGTGTTTG
AGCATGTAGACCAGGACCTAAGGACATATCTGGACAAGGCACCCCCACCAGGCTTGCCAGCCGAAACGAT
CAAGGATCTGATGCGCCAGTTTCTAAGAGGCCTAGATTTCCTTCATGCCAATTGCATCGTTCACCGAGAT
CTGAAGCCAGAGAACATTCTGGTGACAAGTGGTGGAACAGTCAAGCTGGCTGACTTTGGCCTGGCCAGAA
TCTACAGCTACCAGATGGCACTTACACCCGTGGTTGTTACACTCTGGTACCGAGCTCCCGAAGTTCTTCT
GCAGTCCACATATGCAACACCTGTGGACATGTGGAGTGTTGGCTGTATCTTTGCAGAGATGTTTCGTCGA
AAGCCTCTCTTCTGTGGAAACTCTGAAGCCGACCAGTTGGGCAAAATCTTTGACCTGATTGGGCTGCCTC
CAGAGGATGACTGGCCTCGAGATGTATCCCTGCCCCGTGGAGCCTTTCCCCCCAGAGGGCCCCGCCCAGT
GCAGTCGGTGGTACCTGAGATGGAGGAGTCGGGAGCACAGCTGCTGCTGGAAATGCTGACTTTTAACCCA
CACAAGCGAATCTCTGCCTTTCGAGCTCTGCAGCACTCTTATCTACATAAGGATGAAGGTAATCCGGAGT
GA


>OriGene 5' read for mutant NM_000075 unedited
ACCGCCGTTGAGCAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAA
CCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGTGGGGGTGAGGGG
GCCTCTCTAGCTTGCGGCCTGTGTCTATGGTCGGGCCCTCTGCGTCCAGCTGCTCCGGACCGAGCTCGGG
TGTATGGGGCCGTAGGAACCGGCTCCGGGGCCCCGATAACGGGCCGCCCCCACAGCACCCCGGGCTGGCG
TGAGGGTCTCCCTTGATCTGAGAATGGCTACCTCTCGATATGAGCCAGTGGCTGAATTTGGGTGTCGGTG
CCTATGGGGACAGTGTACAAGGCCCGTGAATCCCCAACAGTGGGCCACTTTGTGGCCCTCATGATTGTGA
AAGTCCCCCAGGGAGGAGGAGGGGGAGGAGGCCTTCCCATCACCCAATTTCGGGAGGGGGCTTTCCGGAA
GGCAACTGGGGGCTTTTGACCATCCCAAAGGTTGCCGGGGTAAGGAACTTCGGGCCACATCCGAAATAGC
CCGGAAATAAAAAATGTTGGGGCCAAGCCCTCCTACATGGGAAACCTAACACCCACCTTTGGGGGCCACT
GTCGG
>SC323460 kinase domain raw sequence. By performing BLASTX analysis with this sequence against NCBI refernce protein database, you can confirm the presence of the kinase-deficient mutation
CYCTGMGCAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTC
AGAATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGTGGGGGTGAGGGGGCCTC
TCTAGCTTGCGGCCTGTGTCTATGGTCGGGCCCTCTGCGTCCAGCTGCTCCGGACCGAGCTCGGGTGTAT
GGGGCCGTAGGAACCGGCTCCGGGGCCCCGATAACGGGCCGCCCC
Restriction Sites Please inquire     
ACCN NM_000075
Insert Size 1960 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This kinase-deficient mutant clone was generated by created by site-directed mutagenesis from the corresponding wild-type clone. See details in "Application of active and kinase-deficient kinome collection for identification of kinases regulating hedgehog signaling." Cell. 2008 May p536-548.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_000075.2, NP_000066.1
RefSeq Size 1474 bp
RefSeq ORF 912 bp
Locus ID 1019
UniProt ID P11802
Domains pkinase, TyrKc, S_TKc
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Bladder cancer, Cell cycle, Chronic myeloid leukemia, Glioma, Melanoma, Non-small cell lung cancer, p53 signaling pathway, Pancreatic cancer, Pathways in cancer, Small cell lung cancer, T cell receptor signaling pathway, Tight junction
Gene Summary The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is highly similar to the gene products of S. cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression. The activity of this kinase is restricted to the G1-S phase, which is controlled by the regulatory subunits D-type cyclins and CDK inhibitor p16(INK4a). This kinase was shown to be responsible for the phosphorylation of retinoblastoma gene product (Rb). Mutations in this gene as well as in its related proteins including D-type cyclins, p16(INK4a) and Rb were all found to be associated with tumorigenesis of a variety of cancers. Multiple polyadenylation sites of this gene have been reported. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes the full length protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...