COPRS (NM_018405) Human Untagged Clone

CAT#: SC323765

COPRS (untagged)-Human chromosome 17 open reading frame 79 (C17orf79)



  "NM_018405" in other vectors (4)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C17orf79; COPR5; HSA272196; TTP1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_018405.2 CCACGGCGTCCAGGGCGACCAGCCGCGGGCCGCAGGGCATGGACCTTCAGGCCGCCGGGG
CCCAGGCGCAGGGGGCCGCGGAGCCGTCTCGGGGCCCGCCGCTGCCTAGCGCGCGGGGGG
CGCCCCCCAGCCCGGAGGCTGGCTTTGCTACAGCTGACCACTCCGGTCAGGAGAGAGAGA
CTGAGAAGGCTATGGATCGACTAGCCCGTGGAACACAGAGCATTCCTAATGACAGTCCTG
CCCGGGGTGAGGGCACCCATTCTGAAGAGGAAGGCTTTGCCATGGATGAGGAGGACTCTG
ATGGAGAACTGAATACCTGGGAGCTGTCAGAAGGGACAAACTGTCCACCCAAGGAACAGC
CTGGCGATCTTTTTAATGAGGACTGGGACTCGGAGTTGAAAGCAGATCAAGGGAATCCAT
ATGATGCTGACGACATCCAGGAGAGCATTTCTCAAGAGCTTAAACCTTGGGTGTGCTGTG
CCCCACAAGGAGACATGATCTATGACCCCAGCTGGCACCATCCGCCTCCACTGATACCCT
ATTATTCCAAGATGGTCTTTGAAACAGGACAGTTTGACGATGCTGAAGATTGAGTGTGGA
GCTTTCTGCCTTGTAGGTGGGCGGGCCTCCACGTCAAGATCTCTTTTCCTGTCTTGGAGG
TGAAAAGTCATATCTGAGAAAATGTTTGCAGTGACCCCTAGTCTGGGGTACACAGACCAG
TGTTCCTTATTGACAGTGTTCAATAAGGCCCCGTCATTCTCGCCAGTCTGTTGTTGTTCT
TAATGGGCTCCTCCTTGAAATGTGTGTGTGTTTGTGTCAAGAGGAGTTGTGTTCTTTGTA
AATAAAGGTTAAAAAAAAAAA
Restriction Sites ECoRI-NOT     
ACCN NM_018405
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_018405.2, NP_060875.1
RefSeq Size 861 bp
RefSeq ORF 555 bp
Locus ID 55352
UniProt ID Q9NQ92
Gene Summary Histone-binding protein required for histone H4 methyltransferase activity of PRMT5. Specifically required for histone H4 'Arg-3' methylation mediated by PRMT5, but not histone H3 'Arg-8' methylation, suggesting that it modulates the substrate specificity of PRMT5. Specifically interacts with the N-terminus of histone H4 but not with histone H3, suggesting that it acts by promoting the association between histone H4 and PRMT5. Involved in CCNE1 promoter repression. Plays a role in muscle cell differentiation by modulating the recruitment of PRMT5 to the promoter of genes involved in the coordination between cell cycle exit and muscle differentiation (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...