COPRS (NM_018405) Human Untagged Clone
CAT＃: SC323765
COPRS (untagged)-Human chromosome 17 open reading frame 79 (C17orf79)
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C17orf79; COPR5; HSA272196; TTP1 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_018405.2
CCACGGCGTCCAGGGCGACCAGCCGCGGGCCGCAGGGCATGGACCTTCAGGCCGCCGGGG
CCCAGGCGCAGGGGGCCGCGGAGCCGTCTCGGGGCCCGCCGCTGCCTAGCGCGCGGGGGG CGCCCCCCAGCCCGGAGGCTGGCTTTGCTACAGCTGACCACTCCGGTCAGGAGAGAGAGA CTGAGAAGGCTATGGATCGACTAGCCCGTGGAACACAGAGCATTCCTAATGACAGTCCTG CCCGGGGTGAGGGCACCCATTCTGAAGAGGAAGGCTTTGCCATGGATGAGGAGGACTCTG ATGGAGAACTGAATACCTGGGAGCTGTCAGAAGGGACAAACTGTCCACCCAAGGAACAGC CTGGCGATCTTTTTAATGAGGACTGGGACTCGGAGTTGAAAGCAGATCAAGGGAATCCAT ATGATGCTGACGACATCCAGGAGAGCATTTCTCAAGAGCTTAAACCTTGGGTGTGCTGTG CCCCACAAGGAGACATGATCTATGACCCCAGCTGGCACCATCCGCCTCCACTGATACCCT ATTATTCCAAGATGGTCTTTGAAACAGGACAGTTTGACGATGCTGAAGATTGAGTGTGGA GCTTTCTGCCTTGTAGGTGGGCGGGCCTCCACGTCAAGATCTCTTTTCCTGTCTTGGAGG TGAAAAGTCATATCTGAGAAAATGTTTGCAGTGACCCCTAGTCTGGGGTACACAGACCAG TGTTCCTTATTGACAGTGTTCAATAAGGCCCCGTCATTCTCGCCAGTCTGTTGTTGTTCT TAATGGGCTCCTCCTTGAAATGTGTGTGTGTTTGTGTCAAGAGGAGTTGTGTTCTTTGTA AATAAAGGTTAAAAAAAAAAA |
| Restriction Sites | ECoRI-NOT |
| ACCN | NM_018405 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_018405.2, NP_060875.1 |
| RefSeq Size | 861 bp |
| RefSeq ORF | 555 bp |
| Locus ID | 55352 |
| UniProt ID | Q9NQ92 |
| Gene Summary | Histone-binding protein required for histone H4 methyltransferase activity of PRMT5. Specifically required for histone H4 'Arg-3' methylation mediated by PRMT5, but not histone H3 'Arg-8' methylation, suggesting that it modulates the substrate specificity of PRMT5. Specifically interacts with the N-terminus of histone H4 but not with histone H3, suggesting that it acts by promoting the association between histone H4 and PRMT5. Involved in CCNE1 promoter repression. Plays a role in muscle cell differentiation by modulating the recruitment of PRMT5 to the promoter of genes involved in the coordination between cell cycle exit and muscle differentiation (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203910 | COPRS (Myc-DDK-tagged)-Human chromosome 17 open reading frame 79 (C17orf79) |
CNY 2400.00 |
|
| RC203910L3 | Lenti ORF clone of Human chromosome 17 open reading frame 79 (C17orf79), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC203910L4 | Lenti ORF clone of Human chromosome 17 open reading frame 79 (C17orf79), mGFP tagged |
CNY 5890.00 |
|
| RG203910 | COPRS (tGFP-tagged) - Human chromosome 17 open reading frame 79 (C17orf79) |
CNY 4000.00 |
