DcR3 (TNFRSF6B) (NM_003823) Human Untagged Clone
CAT#: SC323770
TNFRSF6B (untagged)-Human tumor necrosis factor receptor superfamily, member 6b, decoy (TNFRSF6B)
CNY 2400.00
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DCR3; DJ583P15.1.1; M68; M68E; TR6 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_003823.2
CCGCAGGCGGACCGGGGGCAAAGGAGGTGGCATGTCGGTCAGGCACAGCAGGGTCCTGTG
TCCGCGCTGAGCCGCGCTCTCCCTGCTCCAGCAAGGACCATGAGGGCGCTGGAGGGGCCA GGCCTGTCGCTGCTGTGCCTGGTGTTGGCGCTGCCTGCCCTGCTGCCGGTGCCGGCTGTA CGCGGAGTGGCAGAAACACCCACCTACCCCTGGCGGGACGCAGAGACAGGGGAGCGGCTG GTGTGCGCCCAGTGCCCCCCAGGCACCTTTGTGCAGCGGCCGTGCCGCCGAGACAGCCCC ACGACGTGTGGCCCGTGTCCACCGCGCCACTACACGCAGTTCTGGAACTACCTGGAGCGC TGCCGCTACTGCAACGTCCTCTGCGGGGAGCGTGAGGAGGAGGCACGGGCTTGCCACGCC ACCCACAACCGTGCCTGCCGCTGCCGCACCGGCTTCTTCGCGCACGCTGGTTTCTGCTTG GAGCACGCATCGTGTCCACCTGGTGCCGGCGTGATTGCCCCGGGCACCCCCAGCCAGAAC ACGCAGTGCCAGCCGTGCCCCCCAGGCACCTTCTCAGCCAGCAGCTCCAGCTCAGAGCAG TGCCAGCCCCACCGCAACTGCACGGCCCTGGGCCTGGCCCTCAATGTGCCAGGCTCTTCC TCCCATGACACCCTGTGCACCAGCTGCACTGGCTTCCCCCTCAGCACCAGGGTACCAGGA GCTGAGGAGTGTGAGCGTGCCGTCATCGACTTTGTGGCTTTCCAGGACATCTCCATCAAG AGGCTGCAGCGGCTGCTGCAGGCCCTCGAGGCCCCGGAGGGCTGGGGTCCGACACCAAGG GCGGGCCGCGCGGCCTTGCAGCTGAAGCTGCGTCGGCGGCTCACGGAGCTCCTGGGGGCG CAGGACGGGGCGCTGCTGGTGCGGCTGCTGCAGGCGCTGCGCGTGGCCAGGATGCCCGGG CTGGAGCGGAGCGTCCGTGAGCGCTTCCTCCCTGTGCACTGATCCTGGCCCCCTCTTATT TATTCTACATCCTTGGCACCCCACTTGCACTGAAAGAGGCTTTTTTTTAAATAGAAGAAA TGAGGTTTTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | ECoRI-NOT |
| ACCN | NM_003823 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_003823.2, NP_003814.1 |
| RefSeq Size | 1124 bp |
| RefSeq ORF | 903 bp |
| Locus ID | 8771 |
| UniProt ID | O95407 |
| Domains | TNFR |
| Protein Families | Secreted Protein |
| Protein Pathways | Cytokine-cytokine receptor interaction |
| Gene Summary | This gene belongs to the tumor necrosis factor receptor superfamily. The encoded protein is postulated to play a regulatory role in suppressing FasL- and LIGHT-mediated cell death. It acts as a decoy receptor that competes with death receptors for ligand binding. Over-expression of this gene has been noted in gastrointestinal tract tumors. Read-through transcription into this gene from the neighboring upstream gene, which encodes regulator of telomere elongation helicase 1 (RTEL1), generates a non-coding transcript. [provided by RefSeq, Feb 2011] Transcript Variant: This variant (M68E) lacks the 5' noncoding exons present in variant M68C, hence contains a shorter 5' UTR. Both variants encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202249 | TNFRSF6B (Myc-DDK-tagged)-Human tumor necrosis factor receptor superfamily, member 6b, decoy (TNFRSF6B) |
CNY 2400.00 |
|
| RC202249L1 | Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 6b, decoy (TNFRSF6B), Myc-DDK-tagged |
CNY 4800.00 |
|
| RC202249L2 | Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 6b, decoy (TNFRSF6B), mGFP tagged |
CNY 5890.00 |
|
| RC202249L3 | Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 6b, decoy (TNFRSF6B), Myc-DDK-tagged |
CNY 4800.00 |
|
| RC202249L4 | Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 6b, decoy (TNFRSF6B), mGFP tagged |
CNY 4800.00 |
|
| RG202249 | TNFRSF6B (tGFP-tagged) - Human tumor necrosis factor receptor superfamily, member 6b, decoy (TNFRSF6B) |
CNY 4000.00 |
|
| SC117738 | TNFRSF6B (untagged)-Human tumor necrosis factor receptor superfamily, member 6b, decoy (TNFRSF6B) |
CNY 2400.00 |
