RNF36 (TRIM69) (NM_080745) Human Untagged Clone
CAT#: SC323841
TRIM69 (untagged)-Human tripartite motif containing 69 (TRIM69), transcript variant b
CNY 3656.00
CNY 7220.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HSD-34; HSD34; RNF36; Trif |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_080745.3
GAACTTTTCTTTCTTCCATCATGCTCTGAGCCCATTCCTTGAAAACTAAAAGGTCCCTGA
CTCCCAGTCTGCAGCCATCCTGGGCCTGCTGAGCTCTGATTCAAGTGCCTGCCTCTGCCC CTTGGTGGGCTGAAGCTTCATGGAGGAGGAGCTTGCCATCCAACAGGGTCAACTGGAGAC AACTCTGAAGGAGCTTCAGACCCTGAGGAACATGCAGAAGGAAGCTATTGCTGCTCACAA GGAAAACAAGCTACATCTGCAGCAACATGTGTCCATGGAGTTTCTAAAGCTGCATCAGTT CCTGCACAGCAAAGAAAAGGACATTTTAACTGAGCTCCGGGAAGAGGGGAAAGCCTTGAA TGAGGAGATGGAGTTGAATCTGAGCCAGCTTCAGGAGCAATGTCTCTTAGCCAAGGATAT GTTGGTGAGCATTCAGGCAAAGACGGAACAACAGAACTCCTTCGACTTTCTCAAAGACAT CACAACTCTCTTACATAGCTTGGAGCAAGGAATGAAGGTGCTGGCAACCAGAGAGCTTAT TTCCAGAAAGCTGAACCTGGGCCAGTACAAAGGTCCTATCCAGTACATGGTATGGAGGGA AATGCAGGACACTCTCTGCCCAGGCCTGTCTCCACTAACTCTGGACCCTAAAACAGCTCA CCCAAATCTGGTGCTCTCCAAAAGCCAAACCAGCGTCTGGCATGGTGACATTAAGAAGAT AATGCCTGATGATCCTGAGAGGTTTGACTCAAGTGTGGCTGTACTGGGCTCAAGAGGCTT CACCTCTGGAAAGTGGTACTGGGAAGTAGAAGTAGCAAAGAAGACAAAATGGACAGTTGG AGTTGTCAGAGAATCCATCATTCGGAAGGGCAGCTGTCCTCTAACTCCTGAGCAAGGATT CTGGCTTTTAAGACTAAGGAACCAAACTGATCTAAAGGCTCTGGATTTGCCTTCTTTCAG TCTGACACTGACTAACAACCTCGACAAGGTGGGCATATACCTGGATTATGAAGGAGGACA GTTGTCCTTCTACAATGCTAAAACCATGACTCACATTTACACCTTCAGTAACACTTTCAT GGAGAAACTTTATCCCTACTTCTGCCCCTGCCTTAATGATGGTGGAGAGAATAAAGAACC ATTGCACATCTTACATCCACAGTAATGAGTCATAATATTATACAAATTCAGAGTGTTATT AAAGAGGTTTTGAAATATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | ECoRI-NOT |
| ACCN | NM_080745 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_080745.3, NP_542783.2 |
| RefSeq Size | 1434 bp |
| RefSeq ORF | 1026 bp |
| Locus ID | 140691 |
| UniProt ID | Q86WT6 |
| Domains | SPRY, PRY |
| Protein Families | Druggable Genome |
| Gene Summary | This gene encodes a member of the RING-B-box-coiled-coil (RBCC) family and encodes a protein with an N-terminal RING finger motif, a PRY domain and a C-terminal SPRY domain. The mouse ortholog of this gene is specifically expressed in germ cells at the round spermatid stages during spermatogenesis and, when overexpressed, induces apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (b) lacks an alternate in-frame exon in the 5' coding region, compared to variant a, resulting in an isoform (b) that is shorter than isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC206702 | TRIM69 (Myc-DDK-tagged)-Human tripartite motif containing 69 (TRIM69), transcript variant b |
CNY 3656.00 |
|
| RC206702L3 | Lenti ORF clone of Human tripartite motif containing 69 (TRIM69), transcript variant b, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC206702L4 | Lenti ORF clone of Human tripartite motif containing 69 (TRIM69), transcript variant b, mGFP tagged |
CNY 5890.00 |
|
| RG206702 | TRIM69 (tGFP-tagged) - Human tripartite motif containing 69 (TRIM69), transcript variant b |
CNY 4370.00 |
|
| SC110796 | TRIM69 (untagged)-Human tripartite motif containing 69 (TRIM69), transcript variant b |
CNY 7220.00 |
