WASHC1 (NM_182905) Human Untagged Clone
CAT#: SC324033
WASH1 (untagged)-Human WAS protein family homolog 1 (WASH1)
CNY 2400.00
CNY 7410.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FAM39E; WASH; WASH1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_182905.1
GCTCCTTGCTGCTCTTCAACACCACCGAGAACCTGTAGAAGAAGTATGTCTTCCTGGACC
CCCTGGCTGGTGCTGTAACAAAGACCCATGTGATGCTGGGGGCAGAGACAGAGGAGAAGC TGTTTGATGCCCCCTTGTCCATCAGCAAGAGAGAGCAGCTGGAACAGCAGGTCCCAGAGA ACTACTTCTATGTGCCAGACCTGGGCCAGGTGCCTGAGATTGATGTTCCATCCTACCTGC CTGACCTGCCCAGCATTGCCAACGACCTCATGTACATTGCCGACCTGGGCCCCGGCATTG CCCCCTCTGCCCCTGGCACCATTCCAGAACTGCCCACCTTCCACACTGAGGTAGCCGAGC CTCTCAAGGCAGACCTACAAGATGGGGTACTAACACCACCCCCACCGCCCCCACCACCAC CCCCAGCTCCTGAGGTGCTGGCCAGTGCACCCCCACTCCCACCCTCAACCGCGGCCCCTG TAGGCCAAGGCGCCAGGCAGGACGACAGCAGCAGCAGCACGTCTCCTTCAGTCCAGGGAG CTCCCAGGGAAGTGGTCGACCCCTCCAGTGGCTGGGCCACTCTGCTAGAGTCCATCCGCC AAGCTGGGGGCATCGGCAAGGCCAAGCTGCGCAGCATGAAGGAGCGAAAGCTGGAGAAGA AGAAGCAGAAGGAGCAGGAGCAAGTGAGAGCCACGAGCCAAGGTGGGCACTTGATGTCGG ATCTCTTCAACAAGCTGGTCATGAGGCGCAAGGGCATCTCTGGGAAAGGACCTGGGGCTG GTGAGGGGCCCGGAGGAGCCTTTGCCCGCGTGTCAGACTCCATCCCTCCTCTGCCGCCAC CGCAGCAGCCACAGGTAGATGAGGACAAGGACGACTGGGAATCCTAGGGGGCTCCATGAC ACCTTCCCCCGCAGACCCAGACTTGGGCCGTTGCTCTGACATGGACACAGCCAGGACAAG CTGCTCAGACCTGCTTCCCTGGGAGGGGGTGACGGAACCAGCACTGTGTGGAGACCAGCT TCAAGGAGCGGAAGGCTGGCTTGAGGCCACACAGCTGGGGCGGGGACTTCTGTCTGCCTG TGCTCCATGGGGGGACGGCTCCACCCAGCCTGTGCCACTGTGTTCTTAAGAGGCTTCCAG AGAAAACGGCACACCAATCAATAAAGAACTGAGCAGAAACCAACAGTGTGCTTTTAATAA AGGACCTCTAGCTGTGCAGGAAAAAAAAAAAAAAAAAA |
Restriction Sites | ECoRI-NOT |
ACCN | NM_182905 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_182905.1, NP_878908.1 |
RefSeq Size | 795 bp |
RefSeq ORF | 795 bp |
Locus ID | 100287171 |
UniProt ID | A8K0Z3 |
Gene Summary | Acts as a nucleation-promoting factor (NPF) at the surface of endosomes, where it recruits and activates the Arp2/3 complex to induce actin polymerization, playing a key role in the fission of tubules that serve as transport intermediates during endosome sorting (PubMed:19922874, PubMed:19922875, PubMed:20498093, PubMed:23452853). Its assembly in the WASH core complex seems to inhibit its NPF activity and via WASHC2 is required for its membrane targeting (PubMed:20498093). Involved in endocytic trafficking of EGF (By similarity). Involved in transferrin receptor recycling. Regulates the trafficking of endosomal alpha5beta1 integrin to the plasma membrane and involved in invasive cell migration (PubMed:22114305). In T-cells involved in endosome-to-membrane recycling of receptors including T-cell receptor (TCR), CD28 and ITGAL; proposed to be implicated in T cell proliferation and effector function. In dendritic cells involved in endosome-to-membrane recycling of major histocompatibility complex (MHC) class II probably involving retromer and subsequently allowing antigen sampling, loading and presentation during T-cell activation (By similarity). Involved in Arp2/3 complex-dependent actin assembly driving Salmonella typhimurium invasion independent of ruffling. Involved in the exocytosis of MMP14 leading to matrix remodeling during invasive migration and implicating late endosome-to-plasma membrane tubular connections and cooperation with the exocyst complex (PubMed:24344185). Involved in negative regulation of autophagy independently from its role in endosomal sorting by inhibiting BECN1 ubiquitination to inactivate PIK3C3/Vps34 activity (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209590 | WASH1 (Myc-DDK-tagged)-Human WAS protein family homolog 1 (WASH1) |
CNY 3656.00 |
|
RC209590L3 | Lenti ORF clone of Human WAS protein family homolog 1 (WASH1), Myc-DDK-tagged |
CNY 5890.00 |
|
RC209590L4 | Lenti ORF clone of Human WAS protein family homolog 1 (WASH1), mGFP tagged |
CNY 6056.00 |
|
RG209590 | WASH1 (tGFP-tagged) - Human WAS protein family homolog 1 (WASH1) |
CNY 5256.00 |
|
SC121084 | WASH1 (untagged)-Human WAS protein family homolog 1 (WASH1) |
CNY 2400.00 |
|
SC317762 | WASH1 (untagged)-Human WAS protein family homolog 1 (WASH1) |
CNY 4024.00 |