ACYP2 (NM_138448) Human Untagged Clone
CAT#: SC324123
ACYP2 (untagged)-Human acylphosphatase 2, muscle type (ACYP2)
CNY 1200.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ACYM; ACYP |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_138448.2
CGGCTGCCCTCGCTCCCAGGCCCCGCAGTCTCATTTGCCGCTTCCGACGCGTGACCCCGG
CGCGCTAGCGTCCGGGACCGGTGACAGGCGCGGGGTGCGCCAAGCAGTCCCATGTGTCCC CTCCCTCTCGCAGCCGCCGCAGTCGCTGCGCCCCGAGCCCCTCTCCGGCTCCTCAACAGA GGGCTCGCCGCCGCCATGTCTACCGCCCAGTCACTCAAATCCGTGGACTACGAGGTGTTC GGAAGAGTGCAGGGTGTTTGCTTCAGAATGTATACAGAAGATGAAGCTAGGAAAATAGGA GTGGTTGGCTGGGTGAAGAATACCAGCAAAGGCACCGTGACAGGCCAAGTGCAGGGGCCA GAAGACAAAGTCAATTCCATGAAGTCCTGGCTGAGCAAGGTTGGAAGCCCTAGTTCTCGC ATTGACCGCACAAACTTTTCTAATGAAAAAACCATCTCTAAGCTTGAATACTCTAATTTT AGTATTAGATACTAATAGAAGAGAAAAATTGTAACACACTGAACAATAGATACTGTATGT TCTTAAGACTATGTATACTAGAATAATAGTAGCAGAGTAGGGTGAAAAGGAACTTTCTGT TCTGAAAGCTAAGCGACTGTACGTGCTACTAAAAATGTCTGACACTGAAATAATTTTACT CAACTATGTTTTCAACAAGCAAAAATATAGTATTCTAAGATTAAAATGTCATTACAAAAT ATTTAGTGTGAACATTTAATTTAAACTTGTCTCATGGAATCTTTAATTTCAATGAACATT ACAGCATATATATGTTATTTGGCGAGACATCAAATAAAGTTAACCATTTAAAAATTAAAA AAAAAAAAAAA |
| Restriction Sites | ECoRI-NOT |
| ACCN | NM_138448 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_138448.2, NP_612457.1 |
| RefSeq Size | 1082 bp |
| RefSeq ORF | 300 bp |
| Locus ID | 98 |
| UniProt ID | P14621 |
| Protein Pathways | Pyruvate metabolism |
| Gene Summary | Acylphosphatase can hydrolyze the phosphoenzyme intermediate of different membrane pumps, particularly the Ca2+/Mg2+-ATPase from sarcoplasmic reticulum of skeletal muscle. Two isoenzymes have been isolated, called muscle acylphosphatase and erythrocyte acylphosphatase on the basis of their tissue localization. This gene encodes the muscle-type isoform (MT). An increase of the MT isoform is associated with muscle differentiation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (3) represents use of an alternate promoter and therefore differs in the 5' UTR and 5' coding region compared to variant 1. The resulting isoform (3) has a shorter and distinct N-terminus compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201976 | ACYP2 (Myc-DDK-tagged)-Human acylphosphatase 2, muscle type (ACYP2) |
CNY 1800.00 |
|
| RC201976L3 | Lenti ORF clone of Human acylphosphatase 2, muscle type (ACYP2), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC201976L4 | Lenti ORF clone of Human acylphosphatase 2, muscle type (ACYP2), mGFP tagged |
CNY 5890.00 |
|
| RG201976 | ACYP2 (tGFP-tagged) - Human acylphosphatase 2, muscle type (ACYP2) |
CNY 3400.00 |
|
| SC309109 | ACYP2 (untagged)-Human acylphosphatase 2, muscle type (ACYP2) |
CNY 3990.00 |
