COQ3 (NM_017421) Human Untagged Clone
CAT#: SC324338
COQ3 (untagged)-Human coenzyme Q3 homolog, methyltransferase (S. cerevisiae) (COQ3)
CNY 3656.00
CNY 6080.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | bA9819.1; DHHBMT; DHHBMTASE; UG0215E05 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_017421.3
GCTATGTGGAGTGGCCGTAAGCTGGGCTCCTCCGGGGGTTGGTTTTTAAGAGTGCTGGGG
CCTGGAGGCTGTAATACAAAAGCTGCGCGTCCCTTAATTTCCTCGGCGGTTTATGTGAAG AACCAGCTCAGTGGGACTCTACAGATTAAACCAGGGGTTTTCAATGAATACAGAACCATA TGGTTCAAATCCTACAGGACGATCTTTTCCTGTTTGAACAGAATAAAGAGTTTCAGGTAC CCTTGGGCGAGACTGTACAGTACTTCCCAAACCACTGTCGACAGCGGTGAGGTAAAAACC TTCTTGGCCCTGGCTCACAAATGGTGGGATGAACAAGGAGTATATGCACCTCTTCATTCC ATGAATGACCTGAGGGTGCCATTTATTAGGGACAATCTTCTGAAAACAATTCCTAATCAC CAGCCAGGAAAACCTTTGTTGGGGATGAAGATTCTTGACGTTGGCTGTGGTGGTGGGCTG TTAACTGAACCTCTAGGGCGGCTTGGGGCTTCAGTTATTGGAATCGACCCTGTGGATGAG AACATTAAAACAGCACAATGCCATAAATCATTTGATCCAGTCCTGGATAAGAGAATAGAG TACAGAGTGTGTTCCCTGGAAGAGATTGTGGAAGAGACTGCAGAAACATTTGATGCTGTT GTAGCTTCTGAAGTTGTAGAACATGTGATTGATCTAGAAACATTTTTACAGTGCTGCTGT CAAGTGTTAAAACCCGGTGGTTCTTTATTCATTACTACAATCAACAAAACACAACTTTCC TATGCCTTGGGAATTGTTTTTTCAGAGCAAATTGCAGGTATTGTACCAAAAGGTACTCAT ACATGGGAGAAGTTTGTTTCACCTGAAACACTAGAGAGCATTCTGGAATCAAATGGTCTG TCAGTTCAAACAGTGGTAGGAATGCTCTATAACCCCTTCTCAGGTTACTGGCATTGGAGT GAAAATACCAGCCTTAACTATGCAGCTCATGCTGTGAAATCCAGGGTCCAGGAACACCCA GCCTCTGCTGAGTTTGTTTTAAAGGGAGAAACAGAAGAGCTCCAAGCTAATGCCTGCACC AATCCAGCTGTGCATGAAAAGCTGAAGAAATGAATTGTTTCTGAGAACTATAGTAATATG GCTTGGATATCTGATGTTTTCAAATACAAGAAATGTACAATTTATCCTTTGAGAGAGAAT CATGAAGAAAAGAAGGTCAATAAAAAGGGCTAAAACCTTGGAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_017421 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_017421.3, NP_059117.3 |
| RefSeq Size | 1265 bp |
| RefSeq ORF | 1110 bp |
| Locus ID | 51805 |
| UniProt ID | Q9NZJ6 |
| Protein Families | Druggable Genome |
| Protein Pathways | Metabolic pathways, Ubiquinone and other terpenoid-quinone biosynthesis |
| Gene Summary | Ubiquinone, also known as coenzyme Q, or Q, is a critical component of the electron transport pathways of both eukaryotes and prokaryotes (Jonassen and Clarke, 2000 [PubMed 10777520]). This lipid consists of a hydrophobic isoprenoid tail and a quinone head group. The tail varies in length depending on the organism, but its purpose is to anchor coenzyme Q to the membrane. The quinone head group is responsible for the activity of coenzyme Q in the respiratory chain. The S. cerevisiae COQ3 gene encodes an O-methyltransferase required for 2 steps in the biosynthetic pathway of coenzyme Q. This enzyme methylates an early coenzyme Q intermediate, 3,4-dihydroxy-5-polyprenylbenzoic acid, as well as the final intermediate in the pathway, converting demethyl-ubiquinone to coenzyme Q. The COQ3 gene product is also capable of methylating the distinct prokaryotic early intermediate 2-hydroxy-6-polyprenyl phenol.[supplied by OMIM, Mar 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC209576 | COQ3 (Myc-DDK-tagged)-Human coenzyme Q3 homolog, methyltransferase (S. cerevisiae) (COQ3) |
CNY 3656.00 |
|
| RC209576L3 | Lenti ORF clone of Human coenzyme Q3 homolog, methyltransferase (S. cerevisiae) (COQ3), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC209576L4 | Lenti ORF clone of Human coenzyme Q3 homolog, methyltransferase (S. cerevisiae) (COQ3), mGFP tagged |
CNY 5890.00 |
|
| RG209576 | COQ3 (tGFP-tagged) - Human coenzyme Q3 homolog, methyltransferase (S. cerevisiae) (COQ3) |
CNY 5256.00 |
|
| SC114104 | COQ3 (untagged)-Human coenzyme Q3 homolog, methyltransferase (S. cerevisiae) (COQ3) |
CNY 3656.00 |
