ERCC8 (NM_001007234) Human Untagged Clone
CAT#: SC324444
ERCC8 (untagged)-Human excision repair cross-complementing rodent repair deficiency, complementation group 8 (ERCC8), transcript variant 3
CNY 2400.00
CNY 3990.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CKN1; CSA; UVSS2 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001007234.1
GGGGGTCATGGCGACGTCCAGTGCTCCAGCCGGTGTGAGGACACGATATGCTGGGGTTTT
TGTCCGCACGCCAAACGGGTTTGGAGGACCCTCTTCGCCTTCGGAGAGCAGAGTCAACAC GGAGAGTTTTGGGACTGGAATTAAATAAAGACAGAGATGTTGAAAGAATCCACGGCGGTG GAATTAACACCCTTGACATTGAACCTGTTGAAGGGAGATACATGTTATCAGGTGGTTCAG ATGGTGTGATTGTACTTTATGACCTTGAGAACTCCAGCAGACAATCTTATTACACATGTA AAGCAGTGTGTTCCATTGGCAGAGATCATCCTGATGTTCACAGATACAGTGTGGAGACTG TACAGTGGTATCCTCATGACACTGGCATGTTCACATCAAGCTCATTTGATAAAACTCTGA AAGTATGGGATACAAATACATTACAAACTGCAGATGTATTTAATTTTGAGGAAACAGTTT ACAGTCATCATATGTCTCCAGTCTCCACCAAGCACTGTTTGGTAGCAGTTGGTACTAGAG GACCCAAAGTACAACTTTGTGACTTGAAGTCTGGATCCTGTTCTCACATTCTACAGGGTA TTTTTATTTTATTTCAAACGGCAACTACTTTGAGTAAACGATTCAATAAAAAGAAACGTT ACTAACAGTGTATTCTTTGTAAGTGACATGACTAATGTACTTTGTGCTGGTTGTTGAGAC TCAGCAGGGAAATAAAGATCCTTCTGTGCATTATTCTTATAAAACTGAACCATTGAAAAC ACATTTATATGAACAATGATCATTGGGGAAGCTCAAACAATATGAAAAATAGTTCTAACT CAAAACCTTGTGTTATTTCTACATTAAAAAAACTAATGCAACTCAGAAAAAAAAAAAAAA AAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001007234 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001007234.1, NP_001007235.1 |
| RefSeq Size | 925 bp |
| RefSeq ORF | 618 bp |
| Locus ID | 1161 |
| UniProt ID | Q13216 |
| Protein Families | Druggable Genome, Transcription Factors |
| Protein Pathways | Nucleotide excision repair, Ubiquitin mediated proteolysis |
| Gene Summary | This gene encodes a WD repeat protein, which interacts with Cockayne syndrome type B (CSB) protein and with p44 protein, a subunit of the RNA polymerase II transcription factor IIH. Mutations in this gene have been identified in patients with hereditary disease Cockayne syndrome (CS). CS cells are abnormally sensitive to ultraviolet radiation and are defective in the repair of transcriptionally active genes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014] Transcript Variant: This variant (3) lacks several 3' exons and has an alternate 3' end compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203124 | ERCC8 (Myc-DDK-tagged)-Human excision repair cross-complementing rodent repair deficiency, complementation group 8 (ERCC8), transcript variant 3 |
CNY 2400.00 |
|
| RC203124L3 | Lenti ORF clone of Human excision repair cross-complementing rodent repair deficiency, complementation group 8 (ERCC8), transcript variant 3, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC203124L4 | Lenti ORF clone of Human excision repair cross-complementing rodent repair deficiency, complementation group 8 (ERCC8), transcript variant 3, mGFP tagged |
CNY 5890.00 |
|
| RG203124 | ERCC8 (tGFP-tagged) - Human excision repair cross-complementing rodent repair deficiency, complementation group 8 (ERCC8), transcript variant 3 |
CNY 4000.00 |
