UBXN8 (NM_005671) Human Untagged Clone
CAT＃: SC324534
UBXN8 (untagged)-Human UBX domain protein 8 (UBXN8)
CNY 2400.00
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | D8S2298E; REP8; UBXD6 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_005671.2
CCCGCCACCATGGCTTCACGTGGGGTTGTTGGCATTTTCTTCCTCTCTGCTGTCCCCCTT
GTGTGTCTGGAGCTCCGGCGTGGGATCCCGGATATAGGAATCAAGGATTTTCTTTTGCTT TGTGGCCGGATTTTGCTACTGCTTGCTCTTCTTACTTTAATTATTTCTGTGACTACCTCA TGGCTTAACTCATTTAAATCTCCCCAAGTTTATCTGAAGGAAGAAGAAGAAAAGAATGAG AAAAGACAAAAACTTGTGAGAAAAAAACAACAAGAAGCACAAGGAGAGAAGGCCAGCAGA TACATAGAGAATGTTTTAAAACCTCACCAGGAAATGAAATTGAGAAAACTGGAGGAGCGC TTTTATCAAATGACGGGTGAAGCCTGGAAATTAAGCAGTGGTCACAAACTTGGGGGTGAT GAAGGTACAAGTCAGACATCTTTTGAAACATCAAACAGAGAAGCAGCAAAGAGCCAGAAC TTGCCTAAACCTTTAACTGAATTTCCGTCTCCTGCTGAACAGCCCACATGCAAGGAGATT CCTGATTTACCTGAAGAACCTTCTCAAACAGCAGAAGAAGTAGTTACTGTTGCTCTCCGA TGTCCCAGTGGGAATGTCCTGAGGAGAAGGTTTTTGAAGTCCTACAGCTCACAGGTCTTA TTTGACTGGATGACGAGAATTGGGTACCACATATCTCTATACAGCCTTTCTACTTCCTTT CCCAGACGGCCTCTGGCAGTGGAGGGAGGCCAGTCGCTGGAGGACATAGGAATAACTGTG GACACTGTACTCATCCTGGAGGAGAAGGAGCAGACCAACTAGGAAAGAAGGGAGAGCTCC CTGTTTGCATGAAGTCAGTTATGCTATGACCTTCTGGCACAATAAAGGCTTCACTTTCAA ATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_005671 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_005671.2, NP_005662.1 |
| RefSeq Size | 1442 bp |
| RefSeq ORF | 813 bp |
| Locus ID | 7993 |
| UniProt ID | O00124 |
| Protein Families | Transmembrane |
| Gene Summary | p97 or VCP (valosin-containing protein) is a versatile ATPase complex, and many cofactors are required for the p97 functional diversity. This gene encodes one of the p97 cofactors. This cofactor is a transmembrane protein and localized in the endoplasmic reticulum (ER) membrane. It tethers p97 to the ER membrane via its UBX domain. The association of this cofactor with p97 facilitates efficient ER-associated degradation of misfolded proteins. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2013] Transcript Variant: This variant (1) encodes the longest isoform (1), which is a transmembrane protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204690 | UBXN8 (Myc-DDK-tagged)-Human UBX domain protein 8 (UBXN8) |
CNY 2400.00 |
|
| RC204690L3 | Lenti ORF clone of Human UBX domain protein 8 (UBXN8), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC204690L4 | Lenti ORF clone of Human UBX domain protein 8 (UBXN8), mGFP tagged |
CNY 5890.00 |
|
| RG204690 | UBXN8 (tGFP-tagged) - Human UBX domain protein 8 (UBXN8) |
CNY 4000.00 |
