BANF1 (NM_001143985) Human Untagged Clone
CAT#: SC324703
BANF1 (untagged)-Human barrier to autointegration factor 1 (BANF1), transcript variant 2
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BAF; BCRP1; D14S1460; NGPS |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC324703 representing NM_001143985.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACAACCTCCCAAAAGCACCGAGACTTCGTGGCAGAGCCCATGGGGGAGAAGCCAGTGGGGAGCCTG GCTGGGATTGGTGAAGTCCTGGGCAAGAAGCTGGAGGAAAGGGGTTTTGACAAGGCCTATGTTGTCCTT GGCCAGTTTCTGGTGCTAAAGAAAGATGAAGACCTCTTCCGGGAATGGCTGAAAGACACTTGTGGCGCC AACGCCAAGCAGTCCCGGGACTGCTTCGGATGCCTTCGAGAGTGGTGCGACGCCTTCTTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001143985 |
| Insert Size | 270 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001143985.1 |
| RefSeq Size | 1122 bp |
| RefSeq ORF | 270 bp |
| Locus ID | 8815 |
| UniProt ID | O75531 |
| MW | 10.1 kDa |
| Gene Summary | The protein encoded by this gene was first identified by its ability to protect retroviruses from intramolecular integration and therefore promote intermolecular integration into the host cell genome. The protein forms a homodimer which localizes to both the nucleus and cytoplasm and is specifically associated with chromosomes during mitosis. This protein binds to double stranded DNA in a non-specific manner and also binds to LEM-domain containing proteins of the nuclear envelope. This protein is thought to facilitate nuclear reassembly by binding with both DNA and inner nuclear membrane proteins and thereby recruit chromatin to the nuclear periphery. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Jan 2009] Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227624 | BANF1 (Myc-DDK-tagged)-Human barrier to autointegration factor 1 (BANF1), transcript variant 2 |
CNY 1200.00 |
|
| RC227624L1 | Lenti ORF clone of Human barrier to autointegration factor 1 (BANF1), transcript variant 2, Myc-DDK-tagged |
CNY 3600.00 |
|
| RC227624L2 | Lenti ORF clone of Human barrier to autointegration factor 1 (BANF1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RC227624L3 | Lenti ORF clone of Human barrier to autointegration factor 1 (BANF1), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC227624L4 | Lenti ORF clone of Human barrier to autointegration factor 1 (BANF1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG227624 | BANF1 (tGFP-tagged) - Human barrier to autointegration factor 1 (BANF1), transcript variant 2 |
CNY 4370.00 |
