ATXN7L3B (NM_001136262) Human Untagged Clone
CAT#: SC324705
ATXN7L3B (untagged)-Human ataxin 7-like 3B (ATXN7L3B)
CNY 1320.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | lnc-SCA7 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001136262, the custom clone sequence may differ by one or more nucleotides
ATGGAGGAAATTTCGTTGGCCAACCTGGATACTAACAAGCTAGAGGCCATCGCTCAGGAG ATTTACGTAGACCTGATAGAGGATTCTTGTTTGGGATTCTGCTTTGAGGTGCACCGGGCA GTCAAGTGTGGCTACTTCTACCTGGAGTTCGCAGAGACTGGTAGCGTGAAGGATTTTGGC ATTCAGCCAGTGGAAGACAAAGGAGCGTGCCGCCTCCCGCTTTGCTCCCTTCCCGGAGAA CCTGGGAATGGGCCTGATCAGCAGCTGCAGCGCTCACCTCCGGAATTCCAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001136262 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001136262.1, NP_001129734.1 |
| RefSeq Size | 3701 bp |
| RefSeq ORF | 294 bp |
| Locus ID | 552889 |
| UniProt ID | Q96GX2 |
| Gene Summary | By binding to ENY2, interferes with the nuclear functions of the deubiquitinase (DUB) module of the SAGA complex which consists of ENY2, ATXN7, ATXN7L3 and the histone deubiquitinating component USP22. Affects USP22 DUB activity toward histones indirectly by changing the subcellular distribution of ENY2 and altering ENY2 availability for ATXN7L3 interaction. Regulates H2B monoubiquitination (H2Bub1) levels through cytoplasmic sequestration of ENY2 resulting in loss of nuclear ENY2-ATXN7L3 association which destabilizes ATXN7L3. Affects protein expression levels of ENY2 and ATXN7L3.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC226766 | ATXN7L3B (Myc-DDK-tagged)-Human ataxin 7-like 3B (ATXN7L3B) |
CNY 1200.00 |
|
| RC226766L3 | Lenti-ORF clone of ATXN7L3B (Myc-DDK-tagged)-Human ataxin 7-like 3B (ATXN7L3B) |
CNY 5890.00 |
|
| RC226766L4 | Lenti-ORF clone of ATXN7L3B (mGFP-tagged)-Human ataxin 7-like 3B (ATXN7L3B) |
CNY 5890.00 |
|
| RG226766 | ATXN7L3B (tGFP-tagged) - Human ataxin 7-like 3B (ATXN7L3B) |
CNY 4370.00 |
其它ATXN7L3B产品
