EIF4E3 (NM_001134650) Human Untagged Clone
CAT#: SC324718
EIF4E3 (untagged)-Human eukaryotic translation initiation factor 4E family member 3 (EIF4E3), transcript variant 4
CNY 3990.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | eIF-4E3; eIF4E-3 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001134650, the custom clone sequence may differ by one or more nucleotides
ATGAGAGGAGAGAGGCGACCACTTTGGGAAGAGGAGAGTAATGCAAAGGGTGGCGTATGG AAGATGAAAGTCCCCAAGGACAGCACGTCCACAGTTTGGAAAGAGTTGCTGTTAGCAACC ATCGGGGAACAGTTCACAGACTGTGCCGCAGCAGATGATGAAGTAATAGGAGTTAGTGTC AGTGTTCGGGACCGAGAAGACGTCGTCCAAGTCTGGAATGTAAATGCCTCTTTAGTGGGT GAAGCGACTGTTTTAGAAAAGATCTATGAACTTCTGCCCCACATAACTTTTAAAGCAGTA TTTTATAAACCCCATGAAGAGCATCATGCTTTTGAAGGTGGACGTGGAAAACAC |
Restriction Sites | Please inquire |
ACCN | NM_001134650 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001134650.1, NP_001128122.1 |
RefSeq Size | 6100 bp |
RefSeq ORF | 357 bp |
Locus ID | 317649 |
UniProt ID | Q8N5X7 |
Gene Summary | EIF4E3 belongs to the EIF4E family of translational initiation factors that interact with the 5-prime cap structure of mRNA and recruit mRNA to the ribosome (Joshi et al., 2004 [PubMed 15153109]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (4) differs in its 5' UTR and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (b) has a shorter N-terminus, compared to isoform a. Variants 2-5 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225053 | EIF4E3 (Myc-DDK-tagged)-Human eukaryotic translation initiation factor 4E family member 3 (EIF4E3), transcript variant 4 |
CNY 1200.00 |
|
RC225053L3 | Lenti-ORF clone of EIF4E3 (Myc-DDK-tagged)-Human eukaryotic translation initiation factor 4E family member 3 (EIF4E3), transcript variant 4 |
CNY 5890.00 |
|
RC225053L4 | Lenti-ORF clone of EIF4E3 (mGFP-tagged)-Human eukaryotic translation initiation factor 4E family member 3 (EIF4E3), transcript variant 4 |
CNY 5890.00 |
|
RG225053 | EIF4E3 (tGFP-tagged) - Human eukaryotic translation initiation factor 4E family member 3 (EIF4E3), transcript variant 4 |
CNY 4370.00 |