SSPN (NM_001135823) Human Untagged Clone
CAT#: SC324730
SSPN (untagged)-Human sarcospan (Kras oncogene-associated gene) (SSPN), transcript variant 2
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DAGA5; KRAG; NSPN; SPN1; SPN2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC324730 representing NM_001135823.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTTTGTGTCTCATATCAGGTTGACGAACGGACATGTATTCAATTTTCTATGAAACTGTTATACTTT CTGCTGAGTGCCCTGGGCCTGACGGTCTGTGTGCTGGCCGTGGCCTTTGCCGCCCACCACTATTCGCAG CTCACACAGTTTACCTGTGAGACCACACTCGACTCTTGCCAGTGCAAACTGCCCTCCTCGGAGCCGCTC AGCAGGACCTTTGTTTACCGGGATGTGACGGACTGTACCAGCGTCACTGGCACTTTCAAACTGTTCTTA CTCATCCAGATGATTCTTAATTTGGTCTGCGGCCTTGTGTGCTTGTTGGCCTGCTTTGTGATGTGGAAA CATAGGTACCAGGTCTTCTATGTGGGTGTCAGGATATGCTCCCTCACGGCTTCCGAAGGCCCCCAGCAA AAGATCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001135823 |
| Insert Size | 423 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001135823.1 |
| RefSeq Size | 4364 bp |
| RefSeq ORF | 423 bp |
| Locus ID | 8082 |
| UniProt ID | Q14714 |
| Protein Families | Druggable Genome, Transmembrane |
| MW | 15.8 kDa |
| Gene Summary | This gene encodes a member of the dystrophin-glycoprotein complex (DGC). The DGC spans the sarcolemma and is comprised of dystrophin, syntrophin, alpha- and beta-dystroglycans and sarcoglycans. The DGC provides a structural link between the subsarcolemmal cytoskeleton and the extracellular matrix of muscle cells. Two alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Oct 2008] Transcript Variant: This variant (2) uses a different segment for its 5' UTR and lacks a 5' coding segment which results in the use of a downstream start codon, compared to variant 1. The resulting protein (isoform 2) is shorter when it is compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227888 | SSPN (Myc-DDK-tagged)-Human sarcospan (Kras oncogene-associated gene) (SSPN), transcript variant 2 |
CNY 2400.00 |
|
| RC227888L3 | Lenti ORF clone of Human sarcospan (Kras oncogene-associated gene) (SSPN), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC227888L4 | Lenti ORF clone of Human sarcospan (Kras oncogene-associated gene) (SSPN), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG227888 | SSPN (tGFP-tagged) - Human sarcospan (Kras oncogene-associated gene) (SSPN), transcript variant 2 |
CNY 4370.00 |
