CITED1 (NM_001144886) Human Untagged Clone
CAT#: SC324775
CITED1 (untagged)-Human Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1 (CITED1), transcript variant 3
CNY 3990.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MSG1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC324775 representing NM_001144886.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCAACAACGTCGAGGCCTGCACTTGATGTCAAGGGTGGCACCTCACCTGCGAAGGAGGATGCCAAC CAAGAGATGAGCTCCGTGGCCTACTCCAACCTTGCGGTGAAAGATCGCAAAGCAGTGGCCATTCTGCAC TACCCTGGGGTAGCCTCAAATGGAACCAAGGCCAGTGGGGCTCCCACTAGTTCCTCGGGATCTCCAATA GGCTCTCCTACAACCACCCCTCCCACTAAACCCCCATCCTTCAACCTGCACCCCGCCCCTCACTTGCTG GCTAGTATGCACCTGCAGAAACTTAATAGCCAGTATCAGGGGATGGCTGCTGCCACTCCAGGCCAACCC GGGGAGGCAGGACCCCTGCAAAACTGGGACTTTGGGGCCCAGGCGGGAGGGGCAGAATCACTCTCTCCT TCTGCTGGTGCCCAGAGCCCTGCTATCATCGATTCGGACCCAGTGGATGAGGAAGTGCTGATGTCGCTG GTGGTGGAACTGGGGTTGGACCGAGCCAATGAGCTTCCGGAGCTGTGGCTGGGGCAGAATGAGTTTGAC TTCACTGCGGACTTTCCATCTAGCTGCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001144886 |
Insert Size | 582 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001144886.1 |
RefSeq Size | 903 bp |
RefSeq ORF | 582 bp |
Locus ID | 4435 |
UniProt ID | Q99966 |
Protein Families | Transcription Factors |
MW | 19.9 kDa |
Gene Summary | This gene encodes a member of the CREB-binding protein/p300-interacting transactivator with Asp/Glu-rich C-terminal domain (CITED) family of proteins. The encoded protein, also known as melanocyte-specific gene 1, may function as a transcriptional coactivator and may play a role in pigmentation of melanocytes. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2009] Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Both variants 1 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227378 | CITED1 (Myc-DDK-tagged)-Human Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1 (CITED1), transcript variant 3 |
CNY 2400.00 |
|
RC227378L3 | Lenti ORF clone of Human Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1 (CITED1), transcript variant 3, Myc-DDK-tagged |
CNY 5890.00 |
|
RC227378L4 | Lenti ORF clone of Human Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1 (CITED1), transcript variant 3, mGFP tagged |
CNY 5890.00 |
|
RG227378 | CITED1 (tGFP-tagged) - Human Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1 (CITED1), transcript variant 3 |
CNY 4370.00 |