Kallikrein 11 (KLK11) (NM_001136032) Human Untagged Clone
CAT#: SC324849
KLK11 (untagged)-Human kallikrein-related peptidase 11 (KLK11), transcript variant 4
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PRSS20; TLSP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC324849 representing NM_001136032.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGGATTCTGCAGTTAATCCTGCTTGCTCTGGCAACAGGGCTTGTAGGGGGAGAGACCAGGATCATC AAGGGGTTCGAGTGCAAGCCTCACTCCCAGCCCTGGCAGGCAGCCCTGTTCGAGAAGACGCGGCTACTC TGTGGGGCGACGCTCATCGCCCCCAGATGGCTCCTGACAGCAGCCCACTGCCTCAAGCCCCGCTACATA GTTCACCTGGGGCAGCACAACCTCCAGAAGGAGGAGGGCTGTGAGCAGACCCGGACAGCCACTGAGTCC TTCCCCCACCCCGGCTTCAACAACAGCCTCCCCAACAAAGACCACCGCAATGACATCATGCTGGTGAAG ATGGCATCGCCAGTCTCCATCACCTGGGCTGTGCGACCCCTCACCCTCTCCTCACGCTGTGTCACTGCT GGCACCAGCTGCCTCATTTCCGGCTGGGGCAGCACGTCCAGCCCCCAGTTACGCCTGCCTCACACCTTG CGATGCGCCAACATCACCATCATTGAGCACCAGAAGTGTGAGAACGCCTACCCCGGCAACATCACAGAC ACCATGGTGTGTGCCAGCGTGCAGGAAGGGGGCAAGGACTCCTGCCAGGGTGACTCCGGGGGCCCTCTG GTCTGTAACCAGTCTCTTCAAGGCATTATCTCCTGGGGCCAGGATCCGTGTGCGATCACCCGAAAGCCT GGTGTCTACACGAAAGTCTGCAAATATGTGGACTGGATCCAGGAGACGATGAAGAACAATTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001136032 |
Insert Size | 753 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001136032.2 |
RefSeq Size | 1195 bp |
RefSeq ORF | 753 bp |
Locus ID | 11012 |
UniProt ID | Q9UBX7 |
Protein Families | Druggable Genome, Protease, Secreted Protein |
MW | 27.5 kDa |
Gene Summary | Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Alternate splicing and the use of alternate promoters results in multiple transcript variants encoding distinct isoforms which are differentially expressed. [provided by RefSeq, Dec 2016] Transcript Variant: This variant (4) has an alternate 5' terminal exon, which results in a downstream translation start codon, compared to variant 2. The encoded isoform (1) has a shorter N-terminus than isoform 2, and is preferentially expressed in brain. Variants 1 and 4 encode the same isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227537 | KLK11 (Myc-DDK-tagged)-Human kallikrein-related peptidase 11 (KLK11), transcript variant 4 |
CNY 2400.00 |
|
RC227537L3 | Lenti ORF clone of Human kallikrein-related peptidase 11 (KLK11), transcript variant 4, Myc-DDK-tagged |
CNY 5890.00 |
|
RC227537L4 | Lenti ORF clone of Human kallikrein-related peptidase 11 (KLK11), transcript variant 4, mGFP tagged |
CNY 5890.00 |
|
RG227537 | KLK11 (tGFP-tagged) - Human kallikrein-related peptidase 11 (KLK11), transcript variant 4 |
CNY 4370.00 |
其它Kallikrein 11产品