COMT (NM_001135162) Human Untagged Clone

CAT#: SC324874

COMT (untagged)-Human catechol-O-methyltransferase (COMT), transcript variant 3



  "NM_001135162" in other vectors (4)

CNY 6270.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


COMT rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HEL-S-98n
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001135162, the custom clone sequence may differ by one or more nucleotides
ATGCCGGAGGCCCCGCCTCTGCTGTTGGCAGCTGTGTTGCTGGGCCTGGTGCTGCTGGTG
GTGCTGCTGCTGCTTCTGAGGCACTGGGGCTGGGGCCTGTGCCTTATCGGCTGGAACGAG
TTCATCCTGCAGCCCATCCACAACCTGCTCATGGGTGACACCAAGGAGCAGCGCATCCTG
AACCACGTGCTGCAGCATGCGGAGCCCGGGAACGCACAGAGCGTGCTGGAGGCCATTGAC
ACCTACTGCGAGCAGAAGGAGTGGGCCATGAACGTGGGCGACAAGAAAGGCAAGATCGTG
GACGCCGTGATTCAGGAGCACCAGCCCTCCGTGCTGCTGGAGCTGGGGGCCTACTGTGGC
TACTCAGCTGTGCGCATGGCCCGCCTGCTGTCACCAGGGGCGAGGCTCATCACCATCGAG
ATCAACCCCGACTGTGCCGCCATCACCCAGCGGATGGTGGATTTCGCTGGCGTGAAGGAC
AAGGTCACCCTTGTGGTTGGAGCGTCCCAGGACATCATCCCCCAGCTGAAGAAGAAGTAT
GATGTGGACACACTGGACATGGTCTTCCTCGACCACTGGAAGGACCGGTACCTGCCGGAC
ACGCTTCTCTTGGAGGAATGTGGCCTGCTGCGGAAGGGGACAGTGCTACTGGCTGACAAC
GTGATCTGCCCAGGTGCGCCAGACTTCCTAGCACACGTGCGCGGGAGCAGCTGCTTTGAG
TGCACACACTACCAATCGTTCCTGGAATACAGGGAGGTGGTGGACGGCCTGGAGAAGGCC
ATCTACAAGGGCCCAGGCAGCGAAGCAGGGCCC
Restriction Sites Please inquire     
ACCN NM_001135162
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001135162.1, NP_001128634.1
RefSeq Size 2279 bp
RefSeq ORF 816 bp
Locus ID 1312
UniProt ID P21964
Protein Families Druggable Genome, Transmembrane
Protein Pathways Metabolic pathways, Tyrosine metabolism
Gene Summary Catechol-O-methyltransferase catalyzes the transfer of a methyl group from S-adenosylmethionine to catecholamines, including the neurotransmitters dopamine, epinephrine, and norepinephrine. This O-methylation results in one of the major degradative pathways of the catecholamine transmitters. In addition to its role in the metabolism of endogenous substances, COMT is important in the metabolism of catechol drugs used in the treatment of hypertension, asthma, and Parkinson disease. COMT is found in two forms in tissues, a soluble form (S-COMT) and a membrane-bound form (MB-COMT). The differences between S-COMT and MB-COMT reside within the N-termini. Several transcript variants are formed through the use of alternative translation initiation sites and promoters. [provided by RefSeq, Sep 2008]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, and 5 all encode isoform MB-COMT and may also make the shorter isoform S-COMT at a low level. MB-COMT is a membrane-bound protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...