EMAP II (AIMP1) (NM_001142416) Human Untagged Clone

CAT#: SC324959

AIMP1 (untagged)-Human aminoacyl tRNA synthetase complex-interacting multifunctional protein 1 (AIMP1), transcript variant 3



  "NM_001142416" in other vectors (4)

CNY 2400.00

CNY 5510.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-AIMP1 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EMAP2; EMAPII; HLD3; p43; SCYE1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC324959 representing NM_001142416.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAAATAATGATGCTGTTCTGAAGAGACTGGAGCAGAAGGGTGCAGAGGCAGATCAAATCATTGAA
TATCTTAAGCAGCAAGTTTCTCTACTTAAGGAGAAAGCAATTTTGCAGGCAACTTTGAGGGAAGAGAAG
AAACTTCGAGTTGAAAATGCTAAACTGAAGAAAGAAATTGAAGAACTGAAACAAGAGCTAATTCAGGCA
GAAATTCAAAATGGAGTGAAGCAAATACCATTTCCATCTGGTACTCCACTGCACGCTAATTCTATGGTT
TCTGAAAATGTGATACAGTCTACAGCAGTAACAACCGTATCTTCTGGTACCAAAGAACAGATAAAAGGA
GGAACAGGAGACGAAAAGAAAGCGAAAGAGAAAATTGAAAAGAAAGGAGAGAAGAAGGAGAAAAAACAG
CAATCAATAGCTGGAAGTGCCGACTCTAAGCCAATAGATGTTTCCCGTCTGGATCTTCGAATTGGTTGC
ATCATAACTGCTAGAAAACACCCTGATGCAGATTCTTTGTATGTGGAAGAAGTAGATGTCGGAGAAATA
GCCCCAAGGACAGTTGTCAGTGGCCTGGTGAATCATGTTCCTCTTGAACAGATGCAAAATCGGATGGTG
ATTTTACTTTGTAACCTGAAACCTGCAAAGATGAGGGGAGTATTATCTCAAGCAATGGTCATGTGTGCT
AGTTCACCAGAGAAAATTGAAATCTTGGCTCCTCCAAATGGGTCTGTTCCTGGAGACAGAATTACTTTT
GATGCTTTCCCAGGAGAGCCTGACAAGGAGCTGAATCCTAAGAAGAAGATTTGGGAGCAGATCCAGCCT
GATCTTCACACTAATGATGAGTGTGTGGCTACATACAAAGGAGTTCCCTTTGAGGTGAAAGGGAAGGGA
GTATGTAGGGCTCAAACCATGAGCAACAGTGGAATCAAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001142416
Insert Size 939 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001142416.1
RefSeq Size 2598 bp
RefSeq ORF 939 bp
Locus ID 9255
UniProt ID Q12904
Protein Families Druggable Genome
MW 34.4 kDa
Gene Summary The protein encoded by this gene is a cytokine that is specifically induced by apoptosis, and it is involved in the control of angiogenesis, inflammation, and wound healing. The release of this cytokine renders the tumor-associated vasculature sensitive to tumor necrosis factor. The precursor protein is identical to the p43 subunit, which is associated with the multi-tRNA synthetase complex, and it modulates aminoacylation activity of tRNA synthetase in normal cells. This protein is also involved in the stimulation of inflammatory responses after proteolytic cleavage in tumor cells. Multiple transcript variants encoding different isoforms have been found for this gene. A pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2008]
Transcript Variant: This variant (3) differs in the 5' UTR and includes an additional segment in the 5' coding region, compared to variant 1. The resulting isoform (b) is longer at the N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to start at a downstream in-frame start codon that is supported by conservation data.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...