SQSTM1 (NM_001142299) Human Untagged Clone
CAT#: SC324989
SQSTM1 (untagged)-Human sequestosome 1 (SQSTM1), transcript variant 3
CNY 7220.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | A170; DMRV; FTDALS3; NADGP; OSIL; p60; p62; p62B; PDB3; ZIP3 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001142299, the custom clone sequence may differ by one or more nucleotides
ATGGCCATGTCCTACGTGAAGGATGACATCTTCCGAATCTACATTAAAGAGAAAAAAGAG TGCCGGCGGGACCACCGCCCACCGTGTGCTCAGGAGGCGCCCCGCAACATGGTGCACCCC AATGTGATCTGCGATGGCTGCAATGGGCCTGTGGTAGGAACCCGCTACAAGTGCAGCGTC TGCCCAGACTACGACTTGTGTAGCGTCTGCGAGGGAAAGGGCTTGCACCGGGGGCACACC AAGCTCGCATTCCCCAGCCCCTTCGGGCACCTGTCTGAGGGCTTCTCGCACAGCCGCTGG CTCCGGAAGGTGAAACACGGACACTTCGGGTGGCCAGGATGGGAAATGGGTCCACCAGGA AACTGGAGCCCACGTCCTCCTCGTGCAGGGGAGGCCCGCCCTGGCCCCACGGCAGAATCA GCTTCTGGTCCATCGGAGGATCCGAGTGTGAATTTCCTGAAGAACGTTGGGGAGAGTGTG GCAGCTGCCCTTAGCCCTCTGGGCATTGAAGTTGATATCGATGTGGAGCACGGAGGGAAA AGAAGCCGCCTGACCCCCGTCTCTCCAGAGAGTTCCAGCACAGAGGAGAAGAGCAGCTCA CAGCCAAGCAGCTGCTGCTCTGACCCCAGCAAGCCGGGTGGGAATGTTGAGGGCGCCACG CAGTCTCTGGCGGAGCAGATGAGGAAGATCGCCTTGGAGTCCGAGGGGCGCCCTGAGGAA CAGATGGAGTCGGATAACTGTTCAGGAGGAGATGATGACTGGACCCATCTGTCTTCAAAA GAAGTGGACCCGTCTACAGGTGAACTCCAGTCCCTACAGATGCCAGAATCCGAAGGGCCA AGCTCTCTGGACCCCTCCCAGGAGGGACCCACAGGGCTGAAGGAAGCTGCCTTGTACCCA CATCTCCCGCCAGAGGCTGACCCGCGGCTGATTGAGTCCCTCTCCCAGATGCTGTCCATG GGCTTCTCTGATGAAGGCGGCTGGCTCACCAGGCTCCTGCAGACCAAGAACTATGACATC GGAGCGGCTCTGGACACCATCCAGTATTCAAAGCATCCCCCGCCGTTG |
Restriction Sites | Please inquire |
ACCN | NM_001142299 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001142299.1, NP_001135771.1 |
RefSeq Size | 2848 bp |
RefSeq ORF | 1071 bp |
Locus ID | 8878 |
UniProt ID | Q13501 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | This gene encodes a multifunctional protein that binds ubiquitin and regulates activation of the nuclear factor kappa-B (NF-kB) signaling pathway. The protein functions as a scaffolding/adaptor protein in concert with TNF receptor-associated factor 6 to mediate activation of NF-kB in response to upstream signals. Alternatively spliced transcript variants encoding either the same or different isoforms have been identified for this gene. Mutations in this gene result in sporadic and familial Paget disease of bone. [provided by RefSeq, Mar 2009] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation from an in-frame downstream start codon compared to variant 1. This results in an isoform (2) with a shorter N-terminus compared to isoform 1. Variants 2 and 3 differ in the 5' UTR, but encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227343 | SQSTM1 (Myc-DDK-tagged)-Human sequestosome 1 (SQSTM1), transcript variant 3 |
CNY 3656.00 |
|
RC227343L3 | Lenti-ORF clone of SQSTM1 (Myc-DDK-tagged)-Human sequestosome 1 (SQSTM1), transcript variant 3 |
CNY 5890.00 |
|
RC227343L4 | Lenti-ORF clone of SQSTM1 (mGFP-tagged)-Human sequestosome 1 (SQSTM1), transcript variant 3 |
CNY 5890.00 |
|
RG227343 | SQSTM1 (tGFP-tagged) - Human sequestosome 1 (SQSTM1), transcript variant 3 |
CNY 4370.00 |