ATP1B4 (NM_001142447) Human Untagged Clone
CAT#: SC324990
ATP1B4 (untagged)-Human ATPase, Na+/K+ transporting, beta 4 polypeptide (ATP1B4), transcript variant 1
CNY 7220.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001142447, the custom clone sequence may differ by one or more nucleotides
ATGAGAAGGCAACTCCGGTCCAGAAGGGCTCCATCCTTTCCTTACAGTTATCGCTACAGA CTCGATGATCCGGATGAAGCGAACCAGAACTACTTAGCAGATGAAGAGGAGGAAGCAGAA GAAGAGGCTCGGGTGACGGTGGTGCCCAAATCGGAGGAGGAGGAAGAAGAGGAGGAGAAA GAAGAGGAGGAAGAGGAGGAAAAGGAGGAGGAAGAGGGTCAAGGTCAGCCAACAGGCAAT GCCTGGTGGCAGAAATTGCAGATCATGAGTGAATACCTGTGGGATCCAGAGAGAAGGATG TTTCTGGCCCGAACAGGTCAGAGTTGGAGCCTGATCTTACTCATTTACTTCTTCTTCTAT GCCTCCTTGGCTGCTGTGATCACCCTCTGCATGTACACACTATTTCTGACCATCAGTCCC TATATACCAACCTTCACGGAGCGGGTAAAGCCTCCTGGAGTTATGATCAGACCCTTCGCC CATAGCCTTAACTTCAACTTCAACGTTTCTGAACCCGACACTTGGCAGCATTATGTGATT AGCCTAAATGGCTTTCTCCAGGGTTATAATGACAGTCTTCAAGAGGAAATGAATGTAGAT TGTCCCCCGGGGCAGTACTTCATCCAAGATGGCAATGAGGATGAGGACAAGAAGGCCTGC CAATTTAAGCGCTCCTTCCTAAAGAACTGCTCTGGTCTGGAGGACCCAACTTTTGGATAC TCTACTGGACAGCCCTGCATCCTTCTAAAGATGAACCGGATTGTAGGCTTTCGTCCTGAG CTTGGAGATCCTGTGAAGGTTTCCTGCAAAGTTCAGAGAGGTGATGAAAATGACATCCGA TCCATCAGTTACTACCCAGAGTCGGCTTCTTTTGACCTCCGCTACTACCCTTACTACGGC AAACTGACTCACGTTAACTACACATCCCCCTTGGTGGCAATGCACTTTACAGACGTGGTG AAGAACCAAGCAGTGCCTGTGCAGTGCCAACTGAAGGGCAAAGGCGTCATAAATGATGTC ATCAATGATCGTTTTGTGGGCAGGGTAATCTTTACCCTGAACATAGAAACT |
Restriction Sites | Please inquire |
ACCN | NM_001142447 |
Insert Size | 4773 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001142447.1, NP_001135919.1 |
RefSeq Size | 4773 bp |
RefSeq ORF | 4773 bp |
Locus ID | 23439 |
UniProt ID | Q9UN42 |
Protein Families | Transmembrane |
Protein Pathways | Cardiac muscle contraction |
Gene Summary | This gene has been found in all vertebrate genomes sequenced to date. However, this gene has undergone a change in function in placental mammals compared to other species. Specifically, in fish, avian, and amphibian species, this gene encodes plasma membrane-bound beta-subunits of Na,K-ATPase. In placental mammals, the encoded protein interacts with the nuclear transcriptional coregulator SKIP and may be involved in the regulation of TGF-beta signaling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (A). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227725 | ATP1B4 (Myc-DDK-tagged)-Human ATPase, Na+/K+ transporting, beta 4 polypeptide (ATP1B4), transcript variant 1 |
CNY 3990.00 |
|
RC227725L3 | Lenti-ORF clone of ATP1B4 (Myc-DDK-tagged)-Human ATPase, Na+/K+ transporting, beta 4 polypeptide (ATP1B4), transcript variant 1 |
CNY 5890.00 |
|
RC227725L4 | Lenti-ORF clone of ATP1B4 (mGFP-tagged)-Human ATPase, Na+/K+ transporting, beta 4 polypeptide (ATP1B4), transcript variant 1 |
CNY 5890.00 |
|
RG227725 | ATP1B4 (tGFP-tagged) - Human ATPase, Na+/K+ transporting, beta 4 polypeptide (ATP1B4), transcript variant 1 |
CNY 4370.00 |