LRRC51 (NM_001145307) Human Untagged Clone
CAT＃: SC325532
LRTOMT (untagged)-Human leucine rich transmembrane and 0-methyltransferase domain containing (LRTOMT), transcript variant 2
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC325532 representing NM_001145307.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAACAAACGGGACTATATGAACACTTCGGTACAGGAGCCCCCTCTTGACTACTCCTTCAGAAGCATC CACGTCATTCAAGATCTGGTAAATGAGGAGCCAAGGACAGGACTACGACCACTGAAGCGTTCAAAGTCG GGGAAATCACTGACCCAGTCCCTGTGGCTGAATAACAATGTTCTCAATGATCTGAGAGACTTCAACCAG GTGGCTTCACAGCTGTTGGAGCACCCAGAGAACCTGGCCTGGATCGACCTGTCCTTTAATGACCTGACT TCCATTGACCCTGTCCTAACAACTTTCTTCAACCTGAGTGTCCTCTATCTTCACGGCAACAGCATCCAG CGCCTGGGGGAGGTGAATAAGCTGGCTGTCCTTCCTCGGCTCCGTAGCCTGACACTCCATGGGAACCCC ATGGAGGAAGAGAAAGGGTATAGAGTACCAGGGTCTGTAGAGATGCCTCACAGGCCTCCATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001145307 |
| Insert Size | 477 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001145307.4 |
| RefSeq Size | 1314 bp |
| RefSeq ORF | 477 bp |
| Locus ID | 220074 |
| UniProt ID | Q96E66 |
| MW | 18.1 kDa |
| Gene Summary | This locus represents naturally occurring readthrough transcription between the neighboring LRRC51 (leucine-rich repeat containing 51) and TOMT (transmembrane O-methyltransferase) genes on chromosome 11. The readthrough transcript encodes a fusion protein that shares sequence identity with each individual gene product. Multiple reports implicate mutations in this gene in nonsyndromic deafness.[provided by RefSeq, Feb 2021] Transcript Variant: This variant (2, also known as B) represents the short transcript form. It lacks a segment in the 3' exon, compared to variant 1. The resulting isoform (LRTOMT1b) is a LRR-containing protein, but has a shorter and distinct C-terminus, compared to isoform LRTOMT1a. This protein is supported by Western blot as reported in PMID:18953341. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC226583 | LRTOMT (Myc-DDK-tagged)-Human leucine rich transmembrane and 0-methyltransferase domain containing (LRTOMT), transcript variant 2 |
CNY 1200.00 |
|
| RC226583L3 | Lenti ORF clone of Human leucine rich transmembrane and 0-methyltransferase domain containing (LRTOMT), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC226583L4 | Lenti ORF clone of Human leucine rich transmembrane and 0-methyltransferase domain containing (LRTOMT), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG226583 | LRTOMT (tGFP-tagged) - Human leucine rich transmembrane and 0-methyltransferase domain containing (LRTOMT), transcript variant 2 |
CNY 4370.00 |
