CMPK1 (NM_001136140) Human Untagged Clone
CAT＃: SC325566
CMPK1 (untagged)-Human cytidine monophosphate (UMP-CMP) kinase 1, cytosolic (CMPK1), transcript variant 2
CNY 3990.00
Product images
CNY 1999.00
CNY 2700.00
热销推荐
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CK; CMK; CMPK; UMK; UMP-CMPK; UMPK |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC325566 representing NM_001136140.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTGAGCCGCTGCCGCAGCGGGCTGCTCCACGTCCTGGGCCTTAGCTTCCTGCTGCAGACCCGCCGG CCGATTCTCCTCTGCTCTCCACGTCTCATGAAGCCGCTGGTCGTGTTCGTCCTCGGCGGCCCCGGCGCC GGCAAGGGGACCCAGTGCGCCCGCATCGTCGAGGAAATGGATCAGACAATGGCTGCCAATGCTCAGAAG AATAAATTCTTGATTGATGGGTTTCCAAGAAATCAAGACAACCTTCAAGGATGGAACAAGACCATGGAT GGGAAGGCAGATGTATCTTTCGTTCTCTTTTTTGACTGTAATAATGAGATTTGTATTGAACGATGTCTT GAGAGGGGAAAGAGTAGTGGTAGGAGTGATGACAACAGAGAGAGCTTGGAAAAGAGAATTCAGACCTAC CTTCAGTCAACAAAGCCAATTATTGACTTATATGAAGAAATGGGGAAAGTCAAGAAAATAGATGCTTCT AAATCTGTTGATGAAGTTTTTGATGAAGTTGTGCAGATTTTTGACAAGGAAGGCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001136140 |
| Insert Size | 540 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001136140.1 |
| RefSeq Size | 2809 bp |
| RefSeq ORF | 540 bp |
| Locus ID | 51727 |
| UniProt ID | P30085 |
| Protein Families | Druggable Genome |
| Protein Pathways | Metabolic pathways, Pyrimidine metabolism |
| MW | 20.2 kDa |
| Gene Summary | This gene encodes one of the enzymes required for cellular nucleic acid biosynthesis. This enzyme catalyzes the transfer of a phosphate group from ATP to CMP, UMP, or dCMP, to form the corresponding diphosphate nucleotide. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Feb 2012] Transcript Variant: This variant (2) lacks an in-frame exon in the coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227412 | CMPK1 (Myc-DDK-tagged)-Human cytidine monophosphate (UMP-CMP) kinase 1, cytosolic (CMPK1), transcript variant 2 |
CNY 2400.00 |
|
| RC227412L3 | Lenti ORF clone of Human cytidine monophosphate (UMP-CMP) kinase 1, cytosolic (CMPK1), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC227412L4 | Lenti ORF clone of Human cytidine monophosphate (UMP-CMP) kinase 1, cytosolic (CMPK1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG227412 | CMPK1 (tGFP-tagged) - Human cytidine monophosphate (UMP-CMP) kinase 1, cytosolic (CMPK1), transcript variant 2 |
CNY 4370.00 |
