Glutathione S Transferase kappa 1 (GSTK1) (NM_001143681) Human Untagged Clone
CAT#: SC325572
GSTK1 (untagged)-Human glutathione S-transferase kappa 1 (GSTK1), nuclear gene encoding mitochondrial protein, transcript variant 4
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | GST; GST13; GST 13-13; GST13-13; GSTK1-1; hGSTK1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC325572 representing NM_001143681.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGGCCCCTGCCGCGCACCGTGGAGCTCTTCTATGACGTGCTGTCCCCCTACTCCTGGCTGGGCTTC GAGATCCTGTGCCGGTATCAGAATATCTGGAACATCAACCTGCAGTTGCGGCCCAGCCTCATAACAGGG ATCATGAAAGACAGTGGAAGTTTGTCTGCCATGCGTTTCCTCACCGCCGTGAACTTGGAGCATCCAGAG ATGCTGGAGAAAGCGTCCCGGGAGCTGTGGATGCGCGTCTGGTCAAGGAATGAAGACATCACCGAGCCG CAGAGCATCCTGGCGGCTGCAGAGAAGGCTGGTATGTCTGCAGAACAAGCCCAGGGACTTCTGGAAAAG ATCGCAACGCCAAAGGTGAAGAACCAGCTCAAGGAGACCACTGAGGCAGCCTGCAGATACGGAGCCTTT GGGCTGCCCATCACCGTGGCCCATGTGGATGGCCAAACCCACATGTTATTTGGCTCTGACCGGATGGAG CTGCTGGCGCACCTGCTGGGAGAGAAGTGGATGGGCCCTATACCTCCAGCCGTGAATGCCAGACTTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001143681 |
| Insert Size | 552 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001143681.1 |
| RefSeq Size | 929 bp |
| RefSeq ORF | 552 bp |
| Locus ID | 373156 |
| UniProt ID | Q9Y2Q3 |
| Protein Pathways | Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450 |
| MW | 20.5 kDa |
| Gene Summary | This gene encodes a member of the kappa class of the glutathione transferase superfamily of enzymes that function in cellular detoxification. The encoded protein is localized to the peroxisome and catalyzes the conjugation of glutathione to a wide range of hydrophobic substates facilitating the removal of these compounds from cells. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009] Transcript Variant: This variant (4) lacks an exon in the coding region compared to variant 1. The encoded protein (isoform d) is shorter compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC226807 | GSTK1 (Myc-DDK-tagged)-Human glutathione S-transferase kappa 1 (GSTK1), nuclear gene encoding mitochondrial protein, transcript variant 4 |
CNY 2400.00 |
|
| RC226807L3 | Lenti ORF clone of Human glutathione S-transferase kappa 1 (GSTK1), nuclear gene encoding mitochondrial protein, transcript variant 4, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC226807L4 | Lenti ORF clone of Human glutathione S-transferase kappa 1 (GSTK1), nuclear gene encoding mitochondrial protein, transcript variant 4, mGFP tagged |
CNY 5890.00 |
|
| RG226807 | GSTK1 (tGFP-tagged) - Human glutathione S-transferase kappa 1 (GSTK1), nuclear gene encoding mitochondrial protein, transcript variant 4 |
CNY 4370.00 |
其它Glutathione S Transferase kappa 1产品
