CNGB1 (NM_001135639) Human Untagged Clone
CAT#: SC325738
CNGB1 (untagged)-Human cyclic nucleotide gated channel beta 1 (CNGB1), transcript variant 2
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CNCG2; CNCG3L; CNCG4; CNG4; CNGB1B; GAR1; GARP; GARP2; RCNC2; RCNCb; RCNCbeta; RP45 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC325738 representing NM_001135639.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTTGGGCTGGGTCCAGAGGGTGCTGCCTCAGCCCCCAGGGACCCCTCGGAAGACCAAGATGCAGGAG GAAGAGGAAGTGGAACCAGAGCCAGAGATGGAGGCGGAGGTGGAACCAGAACCGAATCCTGAGGAGGCC GAGACAGAGTCCGAGTCCATGCCCCCCGAAGAGTCATTCAAGGAGGAGGAAGTGGCTGTGGCAGACCCA AGCCCTCAGGAGACCAAGGAGGCTGCCCTTACTTCCACCATATCCCTCCGGGCCCAGGGCGCTGAGATT TCTGAAATGAATAGTCCCAGCCGCAGGGTACTGACCTGGCTCATGAAGGGCGTAGAGAAGGTGATCCCG CAGCCTGTTCACAGCATCACGGAGGACCCGGCTCAGATCCTGGGGCATGGCAGCACTGGGGACACAGGG TGCACAGATGAACCCAATGAGGCCCTTGAGGCCCAAGACACTAGGCCTGGGCTGCGGCTGCTTCTGTGG CTGGAGCAGAATCTGGAAAGAGTGCTTCCTCAGCCCCCCAAATCCTCTGAGGTCTGGAGAGATGAGCCT GCAGTTGCTACAGGTGCTGCCTCAGACCCAGCGCCTCCAGGACGCCCCCAGGAAATGGGGCCCAAGCTG CAGGCCCGGGAGACCCCCTCCCTGCCCACACCCATCCCCCTGCAGCCCAAGGAGGAACCCAAGGAGGCA CCAGCTCCAGAGCCCCAGCCCGGCTCCCAGGCCCAGACCTCCTCCCTGCCACCAACCAGGGACCCTGCC AGGCTGGTGGCATGGGTCCTGCACAGGCTGGAGATGGCCTTGCCGCAGCCAGTGCTACATGGGAAAATA GGGGAACAGGAGCCTGACTCCCCTGGGATATGTGATGTGCAGACCAGGGTGATGGGAGCTGGAGGTCTC TGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001135639 |
| Insert Size | 900 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001135639.1 |
| RefSeq Size | 1648 bp |
| RefSeq ORF | 900 bp |
| Locus ID | 1258 |
| UniProt ID | Q14028 |
| Protein Families | Druggable Genome, Ion Channels: Cyclic nucleotide gated |
| Protein Pathways | Olfactory transduction |
| MW | 32.5 kDa |
| Gene Summary | In humans, the rod photoreceptor cGMP-gated cation channel helps regulate ion flow into the rod photoreceptor outer segment in response to light-induced alteration of the levels of intracellular cGMP. This channel consists of two subunits, alpha and beta, with the protein encoded by this gene representing the beta subunit. Defects in this gene are a cause of cause of retinitis pigmentosa type 45. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013] Transcript Variant: This variant (2) uses an alternate exon and lacks the 3' coding region, compared to variant 1. The resulting isoform (b), also known as GARP2, is much shorter and has a unique C-terminus, compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC226950 | CNGB1 (Myc-DDK-tagged)-Human cyclic nucleotide gated channel beta 1 (CNGB1), transcript variant 2 |
CNY 3600.00 |
|
| RC226950L3 | Lenti ORF clone of Human cyclic nucleotide gated channel beta 1 (CNGB1), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC226950L4 | Lenti ORF clone of Human cyclic nucleotide gated channel beta 1 (CNGB1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG226950 | CNGB1 (tGFP-tagged) - Human cyclic nucleotide gated channel beta 1 (CNGB1), transcript variant 2 |
CNY 5200.00 |
