Claudin 5 (CLDN5) (NM_001130861) Human Untagged Clone
CAT#: SC325743
CLDN5 (untagged)-Human claudin 5 (CLDN5), transcript variant 1
CNY 3600.00
| Cited in 2 publications. |
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AWAL; BEC1; CPETRL1; TMDVCF; TMVCF |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001130861 edited
AGCTGCCAGAGGCTCTGTGATTGGCTGCGGCACGATGACCCGCGCACGGATTGGCTGCTT CGGGCCGGGGGGCCGGGCCCGGGGGACAGAATCCGCCCCCGAACCTTCAAAGAGGGTACC CCCCGGCAGGAGCTGGCAGACCCAGGAGGTGCGACAGACCCGCGGGGCAAACGGACTGGG GCCAAGAGCCGGGAGCGCGGGCGCAAAGGCACCAGGGCCCGCCCAGGGCGCCGCGCAGCA CGGCCTTGGGGGTTCTGCGGGCCTTCGGGTGCGCGTCTCGCCTCTAGCCATGGGGTCCGC AGCGTTGGAGATCCTGGGCCTGGTGCTGTGCCTGGTGGGCTGGGGGGGTCTGATCCTGGC GTGCGGGCTGCCCATGTGGCAGGTGACCGCCTTCCTGGACCACAACATCGTGACGGCGCA GACCACCTGGAAGGGGCTGTGGATGTCGTGCGTGGTGCAGAGCACCGGGCACATGCAGTG CAAAGTGTACGACTCGGTGCTGGCTCTGAGCACCGAGGTGCAGGCGGCGCGGGCGCTCAC CGTGAGCGCCGTGCTGCTGGCGTTCGTTGCGCTCTTCGTGACCCTGGCGGGCGCGCAGTG CACCACCTGCGTGGCCCCGGGCCCGGCCAAGGCGCGTGTGGCCCTCACGGGAGGCGTGCT CTACCTGTTTTGCGGGCTGCTGGCGCTCGTGCCACTCTGCTGGTTCGCCAACATTGTCGT CCGCGAGTTTTACGACCCGTCTGTGCCCGTGTCGCAGAAGTACGAGCTGGGCGCAGCGCT GTACATCGGCTGGGCGGCCACCGCGCTGCTCATGGTAGGCGGCTGCCTCTTGTGCTGCGG CGCCTGGGTCTGCACCGGCCGTCCCGACCTCAGCTTCCCCGTGAAGTACTCAGCGCCGCG GCGGCCCACGGCCACCGGCGACTACGACAAGAAGAACTACGTCTGAGGGCGCTGGGCACG GCCGGGCCCCTCCTGCCAGCCACGCCTGCGAGGCGTTGGATAAGCCTGGGGAGCCCCGCA TGGACCGCGGCTTCCGCCGGGTAGCGCGGCGCGCAGGCTCCTCGGAACGTCCGGCTCTGC GCCCCGACGCGGCTCCTGGATCCGCTCCTGCCTGCGCCCGCAGCTGACCTTCTCCTGCCA CTAGCCCGGCCCTGCCCTTAACAGACGGAATGAAGTTTCCTTTTCTGTGCGCGGCGCTGT TTCCATAGGCAGAGCGGGTGTCAGACTGAGGATTTCGCTTCCCCTCCAAGACGCTGGGGG TCTTGGCTGCTGCCTTACTTCCCAGAGGCTCCTGCTGACTTCGGAGGGGCGGATGCAGAG CCCAGGGCCCCCACCGGAAGATGTGTACAGCTGGTCTTTACTCCATCGGCAGGGCCCGAG CCCAGGGACCAGTGACTTGGCCTGGACCTCCCGGTCTCACTCCAGCATCTCCCCAGGCAA GGCTTGTGGGCACCGGAGCTTGAGAGAGGGCGGGAGTGGGAAGGCTAAGAATCTGCTTAG TAAATGGTTTGAACTCTCAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001130861 |
| Insert Size | 1500 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001130861.1, NP_001124333.1 |
| RefSeq Size | 2332 bp |
| RefSeq ORF | 912 bp |
| Locus ID | 7122 |
| UniProt ID | O00501 |
| Protein Families | Transmembrane |
| Protein Pathways | Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction |
| Gene Summary | This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets. Mutations in this gene have been found in patients with velocardiofacial syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2018] Transcript Variant: This variant (1) represents the longest transcript and encodes a protein of 303 aa (isoform 1). A common SNP (rs885985) encodes a stop codon in the 5' coding region and thus, for some haplotypes, translation is predicted to initiate from a downstream AUG to produce a protein of 218 aa (isoform 2). |
Citations (2)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Two common human CLDN5 alleles encode different open reading frames but produce one protein isoform
,Cornely, RM;Schlingmann, B;Shepherd, WS;Chandler, JD;Neujahr, DC;Koval, M;,
Ann. N. Y. Acad. Sci.
,PubMed ID 28445614
[CLDN5]
|
|
ETS-related Gene (ERG) Controls Endothelial Cell Permeability via Transcriptional Regulation of the Claudin 5 (CLDN5) Gene
,Lei Yuan, Alexandra Le Bras, Anastasia Sacharidou, Kiyoshi Itagaki, Yumei Zhan, Maiko Kondo, Christopher V. Carman, George E. Davis, William C. Aird, and Peter Oettgen,
J. Biol. Chem., Feb 2012; 287: 6582 - 6591.
[cldn5]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225423 | CLDN5 (Myc-DDK-tagged)-Human claudin 5 (CLDN5), transcript variant 1 |
CNY 3600.00 |
|
| RC225423L1 | Lenti ORF clone of Human claudin 5 (CLDN5), transcript variant 1, Myc-DDK-tagged |
CNY 6000.00 |
|
| RC225423L2 | Lenti ORF clone of Human claudin 5 (CLDN5), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RC225423L3 | Lenti ORF clone of Human claudin 5 (CLDN5), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC225423L4 | Lenti ORF clone of Human claudin 5 (CLDN5), transcript variant 1, mGFP tagged |
CNY 6000.00 |
|
| RG225423 | CLDN5 (tGFP-tagged) - Human claudin 5 (CLDN5), transcript variant 1 |
CNY 5200.00 |
其它Claudin 5产品
