Syntaxin 16 (STX16) (NM_001134773) Human Untagged Clone

CAT#: SC325749

STX16 (untagged)-Human syntaxin 16 (STX16), transcript variant 4



  "NM_001134773" in other vectors (4)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-STX16 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SYN16
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325749 representing NM_001134773.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCACCAGGCGTTTAACCGACGCTTTCTTGTTGTTGCGGAATAATTCCATCCAAAACCGGCAGCTG
TTAGCCGAGCAAGAGCTGGACGAGCTTGCTGATGACCGTATGGCACTGGTGTCAGGCATCAGCTTAGAT
CCAGAAGCAGCGATTGGTGTGACAAAACGGCCACCTCCTAAGTGGGTGGATGGAGTGGATGAAATTCAG
TATGATGTTGGCCGGATTAAGCAGAAGATGAAAGAATTGGCCAGCCTTCATGACAAGCATTTAAACAGA
CCCACCCTGGATGACAGCAGCGAAGAGGAACATGCCATTGAGATAACTACCCAAGAGATCACTCAGCTC
TTCCACAGGTGCCAGCGTGCCGTGCAGGCCCTGCCGAGCCGGGCCCGGGCCTGCTCCGAGCAGGAGGGG
CGGCTGCTTGGGAACGTGGTGGCCTCGCTGGCGCAGGCCCTGCAGGAACTCTCCACCAGCTTCCGGCAC
GCACAGTCAGGCTACCTCAAACGCATGAAGAATCGAGAGGAAAGATCCCAGCATTTTTTCGACACATCA
GTACCACTAATGGATGATGGAGACGATAACACTCTTTACCATCGGGGTTTTACAGAGGACCAGTTAGTT
CTGGTGGAGCAGAACACACTGATGGTGGAAGAGCGGGAACGAGAGATTCGCCAGATTGTACAGTCCATT
TCTGACCTGAATGAAATATTCAGGGACTTAGGGGCGATGATTGTAGAACAGGGTACAGTCCTTGACAGA
ATTGACTATAACGTTGAACAGTCCTGTATCAAAACTGAAGATGGTTTGAAACAGCTTCACAAGGCAGAA
CAGTATCAAAAGAAGAATCGGAAGATGCTTGTGATTTTAATATTATTTGTCATCATCATTGTGCTCATT
GTTGTCCTCGTTGGCGTGAAGTCTCGATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001134773
Insert Size 927 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001134773.2
RefSeq Size 4927 bp
RefSeq ORF 927 bp
Locus ID 8675
UniProt ID O14662
Protein Families Druggable Genome, Transmembrane
Protein Pathways SNARE interactions in vesicular transport
MW 35.3 kDa
Gene Summary This gene encodes a protein that is a member of the syntaxin or t-SNARE (target-SNAP receptor) family. These proteins are found on cell membranes and serve as the targets for V-SNARES (vesicle-SNAP receptors) permitting specific synaptic vesicle docking and fusion. A microdeletion in the region of chromosome 20 where this gene is located has been associated with pseudohypoparathyroidism type Ib. Multiple transcript variants have been found for this gene. Read-through transcription also exists between this gene and the neighboring downstream aminopeptidase-like 1 (NPEPL1) gene. [provided by RefSeq, Mar 2011]
Transcript Variant: This variant (4) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1, resulting in a shorter isoform (d), compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...