UBAC2 (NM_001144072) Human Untagged Clone
CAT#: SC325797
UBAC2 (untagged)-Human UBA domain containing 2 (UBAC2), transcript variant 1
CNY 3656.00
CNY 5610.00
Product images
                    
                Specifications
| Product Data | |
| Type | Human Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | PHGDHL1 | 
| Vector | pCMV6-XL4 | 
| E. coli Selection | Ampicillin (100 ug/mL) | 
| Mammalian Cell Selection | None | 
| Sequence Data | 
                
                
                
                 >OriGene ORF sequence for NM_001144072 edited 
ATGTTCACCAGCACCGGCTCCAGTGGGCTCTACAAGGCGCCTCTGTCGAAGAGCCTTCTG CTGGTCCCCAGTGCCCTCTCCCTCCTGCTCGCCCTCCTCCTGCCTCACTGCCAGAAGCTC TTTGTGTATGACCTTCACGCAGTCAAGAACGACTTCCAGATTTGGAGGTTGATATGTGGA AGAATAATTTGCCTTGATTTGAAAGATACTTTCTGCAGTAGTCTGCTTATTTATAATTTT AGGATATTTGAAAGAAGATATGGAAGCAGAAAATTTGCATCCTTTTTGCTGGGTTCCTGG GTTTTGTCAGCCTTATTTGACTTTCTCCTCATTGAAGCTATGCAGTATTTCTTTGGCATC ACTGCAGCTAGTAATTTGCCTTCTGGATTCCTGGCACCTGTGTTTGCTCTGTTTGTACCA TTTTACTGCTCCATACCAAGAGTCCAAGTGGCACAAATTCTGGGTCCGTTGTCCATCACA AACAAGACATTGATTTATATATTGGGACTGCAGCTTTTCACCTCTGGTTCCTACATCTGG ATTGTAGCCATAAGTGGACTTATGTCCGGTCTGTGCTACGACAGCAAAATGTTCCAGGTG CATCAGGTGCTCTGCATCCCCAGCTGGATGGCAAAATTCTTTTCTTGGACACTTGAACCC ATCTTCTCTTCTTCAGAACCCACCAGCGAAGCCAGAATTGGGATGGGAGCCACGCTGGAC ATCCAGAGACAGCAGAGAATGGAGCTGCTGGACCGGCAGCTGATGTTCTCTCAGTTTGCA CAAGGGAGGCGACAGAGACAGCAGCAGGGAGGAATGATCAATTGGAATCGTCTTTTTCCT CCTTTACGTCAGCGACAAAACGTAAACTATCAGGGCGGTCGGCAGTCTGAGCCAGCAGCG CCCCCTCTAGAAGTTTCTGAGGAACAGGTCGCCCGGCTCATGGAGATGGGATTTTCCAGA GGTGATGCTTTGGAAGCCCTGAGAGCTTCAAACAATGACCTCAATGTCGCCACCAACTTC CTGCTGCAGCACTGA  | 
        
| Restriction Sites | Please inquire | 
| ACCN | NM_001144072 | 
| Insert Size | 2200 bp | 
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). | 
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_001144072.1, NP_001137544.1 | 
| RefSeq Size | 2696 bp | 
| RefSeq ORF | 1035 bp | 
| Locus ID | 337867 | 
| UniProt ID | Q8NBM4 | 
| Protein Families | Druggable Genome, Transmembrane | 
| Gene Summary | Restricts trafficking of FAF2 from the endoplasmic reticulum to lipid droplets.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longer isoform (1).  | 
        
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| RC227924 | UBAC2 (Myc-DDK-tagged)-Human UBA domain containing 2 (UBAC2), transcript variant 1 | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 3656.00  | 
                                            |
| RC227924L1 | Lenti ORF clone of Human UBA domain containing 2 (UBAC2), transcript variant 1, Myc-DDK-tagged | 
                                                     CNY 6056.00  | 
                                            |
| RC227924L2 | Lenti ORF clone of Human UBA domain containing 2 (UBAC2), transcript variant 1, mGFP tagged | 
                                                     CNY 5890.00  | 
                                            |
| RC227924L3 | Lenti ORF clone of Human UBA domain containing 2 (UBAC2), transcript variant 1, Myc-DDK-tagged | 
                                                     CNY 5890.00  | 
                                            |
| RC227924L4 | Lenti ORF clone of Human UBA domain containing 2 (UBAC2), transcript variant 1, mGFP tagged | 
                                                     CNY 5890.00  | 
                                            |
| RG227924 | UBAC2 (tGFP-tagged) - Human UBA domain containing 2 (UBAC2), transcript variant 1 | 
                                                     CNY 4370.00  | 
                                            
