NEK6 (NM_001145001) Human Untagged Clone
CAT#: SC325800
NEK6 (untagged)-Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6), transcript variant 1
CNY 5610.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | SID6-1512 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC325800 representing NM_001145001.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCCAGGAGAGAAGTTTGCTGGGAGGCAGCTCATTTCCGGCAGGAGGAGCAGAGCCTGCCAAGGCCT CGAGTTCGTGCCCTCGTGAGGCTGGCATGCAGGATGGCAGGACAGCCCGGCCACATGCCCCATGGAGGG AGTTCCAACAACCTCTGCCACACCCTGGGGCCTGTGCATCCTCCTGACCCACAGAGGCATCCCAACACG CTGTCTTTTCGCTGCTCGCTGGCGGACTTCCAGATCGAAAAGAAGATAGGCCGAGGACAGTTCAGCGAG GTGTACAAGGCCACCTGCCTGCTGGACAGGAAGACAGTGGCTCTGAAGAAGGTGCAGATCTTTGAGATG ATGGACGCCAAGGCGAGGCAGGACTGTGTCAAGGAGATCGGCCTCTTGAAGCAACTGAACCACCCAAAT ATCATCAAGTATTTGGACTCGTTTATCGAAGACAACGAGCTGAACATTGTGCTGGAGTTGGCTGACGCA GGGGACCTCTCGCAGATGATCAAGTACTTTAAGAAGCAGAAGCGGCTCATCCCGGAGAGGACAGTATGG AAGTACTTTGTGCAGCTGTGCAGCGCCGTGGAGCACATGCATTCACGCCGGGTGATGCACCGAGACATC AAGCCTGCCAACGTGTTCATCACAGCCACGGGCGTCGTGAAGCTCGGTGACCTTGGTCTGGGCCGCTTC TTCAGCTCTGAGACCACCGCAGCCCACTCCCTAGTGGGGACGCCCTACTACATGTCACCGGAGAGGATC CATGAGAACGGCTACAACTTCAAGTCCGACATCTGGTCCCTGGGCTGTCTGCTGTACGAGATGGCAGCC CTCCAGAGCCCCTTCTATGGAGATAAGATGAATCTCTTCTCCCTGTGCCAGAAGATCGAGCAGTGTGAC TACCCCCCACTCCCCGGGGAGCACTACTCCGAGAAGTTACGAGAACTGGTCAGCATGTGCATCTGCCCT GACCCCCACCAGAGACCTGACATCGGATACGTGCACCAGGTGGCCAAGCAGATGCACATCTGGATGTCC AGCACCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001145001 |
Insert Size | 1044 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001145001.2 |
RefSeq Size | 2810 bp |
RefSeq ORF | 1044 bp |
Locus ID | 10783 |
UniProt ID | Q9HC98 |
Protein Families | Druggable Genome, Protein Kinase |
MW | 39.8 kDa |
Gene Summary | The protein encoded by this gene is a kinase required for progression through the metaphase portion of mitosis. Inhibition of the encoded protein can lead to apoptosis. This protein also can enhance tumorigenesis by suppressing tumor cell senescence. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Variants 1 and 7 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227083 | NEK6 (Myc-DDK-tagged)-Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6), transcript variant 1 |
CNY 5488.00 |
|
RC227083L1 | Lenti ORF clone of Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6), transcript variant 1, Myc-DDK-tagged |
CNY 7888.00 |
|
RC227083L2 | Lenti ORF clone of Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RC227083L3 | Lenti ORF clone of Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC227083L4 | Lenti ORF clone of Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG227083 | NEK6 (tGFP-tagged) - Human NIMA (never in mitosis gene a)-related kinase 6 (NEK6), transcript variant 1 |
CNY 4370.00 |