GUCY1A3 (NM_001130686) Human Untagged Clone

CAT#: SC325830

GUCY1A3 (untagged)-Human guanylate cyclase 1, soluble, alpha 3 (GUCY1A3), transcript variant 6



  "NM_001130686" in other vectors (4)

CNY 5990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GUCY1A1 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GC-SA3; GUC1A3; GUCA3; GUCSA3; GUCY1A1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325830 representing NM_001130686.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTCTGCACGAAGCTCAAGGATCTCAAGATCACAGGAGAGTGTCCTTTCTCCTTACTGGCACCAGGT
CAAGTTCCTAACGAGTCTTCAGAGGAGGCAGCAGGAAGCTCAGAGAGCTGCAAAGCAACCGTGCCCATC
TGTCAAGACATTCCTGAGAAGAACATACAAGAAAGTCTTCCTCAAAGAAAAACCAGTCGGAGCCGAGTC
TATCTTCACACTTTGGCAGAGAGTATTTGCAAACTGATTTTCCCAGAGTTTGAACGGCTGAATGTTGCA
CTTCAGAGAACATTGGCAAAGCACAAAATAAAAGAAAGCAGGAAATCTTTGGAAAGAGAAGACTTTGAA
AAAACAATTGCAGAGCAAGCAGTTGCAGCAGGAGTTCCAGTGGAGGTTATCAAAGAATCTCTTGGTGAA
GAGGTTTTTAAAATATGTTACGAGGAAGATGAAAACATCCTTGGGGTGGTTGGAGGCACCCTTAAAGAT
TTTTTAAACAGCTTCAGTACCCTTCTGAAACAGAGCAGCCATTGCCAAGAAGCAGGAAAAAGGGGCAGG
CTTGAGGACGCCTCCATTCTATGCCTGGATAAGGAGGATGATTTTCTACATGTTTACTACTTCTTCCCT
AAGAGAACCACCTCCCTGATTCTTCCCGGCATCATAAAGGCAGCTGCTCACGTATTATATGAAACGGAA
GTGGAAGTGTCGTTAATGCCTCCCTGCTTCCATAATGATTGCAGCGAGTTTGTGAATCAGCCCTACTTG
TTGTACTCCGTTCACATGAAAAGCACCAAGCCATCCCTGTCCCCCAGCAAACCCCAGTCCTCGCTGGTG
ATTCCCACATCGCTATTCTGCAAGACATTTCCATTCCATTTCATGTTTGACAAAGATATGACAATTCTG
CAATTTGGCAATGGCATCAGAAGGCTGATGAACAGGAGAGACTTTCAAGGAAAGCCTAATTTTGAAGAA
TACTTTGAAATTCTGACTCCAAAAATCAACCAGACGTTTAGCGGGATCATGACTATGTTGAATATGCAG
TTTGTTGTACGAGTGAGGAGATGGGACAACTCTGTGAAAAAATCTTCAAGGGTAAGGAAAACATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001130686
Insert Size 1101 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001130686.1
RefSeq Size 1658 bp
RefSeq ORF 1101 bp
Locus ID 2982
Protein Families Druggable Genome
Protein Pathways Gap junction, Long-term depression, Purine metabolism, Vascular smooth muscle contraction
MW 41.7 kDa
Gene Summary Soluble guanylate cyclases are heterodimeric proteins that catalyze the conversion of GTP to 3',5'-cyclic GMP and pyrophosphate. The protein encoded by this gene is an alpha subunit of this complex and it interacts with a beta subunit to form the guanylate cyclase enzyme, which is activated by nitric oxide. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (6) differs in the 5' UTR and uses an alternate splice site in the 3' coding region that results in a premature translation termination site, compared to variant 1. The encoded protein (isoform C) has a shorter and distinct C-terminus, compared to isoform A.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...