VRK2 (NM_001130483) Human Untagged Clone

CAT#: SC325877

VRK2 (untagged)-Human vaccinia related kinase 2 (VRK2), transcript variant 5



  "NM_001130483" in other vectors (4)

CNY 6460.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
VRK2 mouse monoclonal antibody,clone OTI2F5
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325877 representing NM_001130483.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCACCAAAAAGAAATGAAAAATACAAACTTCCTATTCCATTTCCAGAAGGCAAGGTTCTGGATGAT
ATGGAAGGCAATCAGTGGGTACTGGGCAAGAAGATTGGCTCTGGAGGATTTGGATTGATATATTTAGCT
TTCCCCACAAATAAACCAGAGAAAGATGCAAGACATGTAGTAAAAGTGGAATATCAAGAAAATGGCCCG
TTATTTTCAGAACTTAAATTTTATCAGAGAGTTGCAAAAAAAGACTGTATCAAAAAGTGGATAGAACGC
AAACAACTTGATTATTTAGGAATTCCTCTGTTTTATGGATCTGGTCTGACTGAATTCAAGGGAAGAAGT
TACAGATTTATGGTAATGGAAAGACTAGGAATAGATTTACAGAAGATCTCAGGCCAGAATGGTACCTTT
AAAAAGTCAACTGTCCTGCAATTAGGTATCCGAATGTTGGATGTACTGGAATATATACATGAAAATGAA
TATGTTCATGGTGATATAAAAGCAGCAAATCTACTTTTGGGTTACAAAAATCCAGACCAGGTTTATCTT
GCAGATTATGGACTTTCCTACAGATATTGTCCCAATGGGAACCACAAACAGTATCAGGAAAATCCTAGA
AAAGGCCATAATGGGACAATAGAGTTTACCAGCTTGGATGCCCACAAGGGAGTAGCCTTGTCCAGACGA
AGTGACGTTGAGATCCTCGGCTACTGCATGCTGCGGTGGTTGTGTGGGAAACTTCCCTGGGAACAGAAC
CTGAAGGACCCTGTGGCTGTGCAGACTGCTAAAACAAATCTGTTGGACGAGCTCCCCCAGTCAGTGCTT
AAATGGGCTCCTTCTGGAAGCAGTTGCTGTGAAATAGCCCAATTTTTGGTATGTGCTCATAGTTTAGCA
TATGATGAAAAGCCAAACTATCAAGCCCTCAAGAAAATTTTGAACCCTCATGGAATACCTTTAGGACCA
CTGGACTTTTCCACAAAAGGACAGAGTATAAATGTCCATACTCCAAACAGTCAAAAAGTTGATTCACAA
AAGGCTGCAACAAAGCAAGTCAACAAGGCACACAATAGGTTAATCGAAAAAAAAGTCCACAGTGAGAGA
AGCGCTGAGTCCTGTGCAACATGGAAAGTGCAGAAAGAGGAGAAACTGATTGGATTGATGAACAATGAA
GCAGCTCAGTTTAGGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001130483
Insert Size 1191 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001130483.2
RefSeq Size 1988 bp
RefSeq ORF 1191 bp
Locus ID 7444
UniProt ID Q86Y07
Protein Families Druggable Genome, Protein Kinase, Transmembrane
MW 45 kDa
Gene Summary This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. The encoded protein acts as an effector of signaling pathways that regulate apoptosis and tumor cell growth. Variants in this gene have been associated with schizophrenia. Alternative splicing results in multiple transcript variants that differ in their subcellular localization and biological activity. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (5) differs in the 5' UTR and contains an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (3) has a shorter and distinct C-terminus, compared to isoform 1. Variants 5 and 9 encode the same isoform (3, also known as VRK2B).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...