SMAD2 (NM_001135937) Human Untagged Clone
CAT＃: SC325924
SMAD2 (untagged)-Human SMAD family member 2 (SMAD2), transcript variant 3
CNY 7030.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | hMAD-2; hSMAD2; JV18; JV18-1; MADH2; MADR2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC325924 representing NM_001135937.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCGTCCATCTTGCCATTCACGCCGCCAGTTGTGAAGAGACTGCTGGGATGGAAGAAGTCAGCTGGT GGGTCTGGAGGAGCAGGCGGAGGAGAGCAGAATGGGCAGGAAGAAAAGTGGTGTGAGAAAGCAGTGAAA AGTCTGGTGAAGAAGCTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCAAAAC TGTAATACTAAATGTGTTACCATACCAAGGTCTCTTGATGGTCGTCTCCAGGTATCCCATCGAAAAGGA TTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCATCATGAACTCAAGGCA ATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACCCTTACCACTATCAG AGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCTAACAGAACTTCCG CCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATTGAGCCACAGAGT AATTATATTCCAGAAACGCCACCTCCTGGATATATCAGTGAAGATGGAGAAACAAGTGACCAACAGTTG AATCAAAGTATGGACACAGGCTCTCCAGCAGAACTATCTCCTACTACTCTTTCCCCTGTTAATCATAGC TTGGATTTACAGCCAGTTACTTACTCAGAACCTGCATTTTGGTGTTCGATAGCATATTATGAATTAAAT CAGAGGGTTGGAGAAACCTTCCATGCATCACAGCCCTCACTCACTGTAGATGGCTTTACAGACCCATCA AATTCAGAGAGGTTCTGCTTAGGTTTACTCTCCAATGTTAACCGAAATGCCACGGTAGAAATGACAAGA AGGCATATAGGAAGAGGAGTGCGCTTATACTACATAGGTGGGGAAGTTTTTGCTGAGTGCCTAAGTGAT AGTGCAATCTTTGTGCAGAGCCCCAATTGTAATCAGAGATATGGCTGGCACCCTGCAACAGTGTGTAAA ATTCCACCAGGCTGTAATCTGAAGATCTTCAACAACCAGGAATTTGCTGCTCTTCTGGCTCAGTCTGTT AATCAGGGTTTTGAAGCCGTCTATCAGCTAACTAGAATGTGCACCATAAGAATGAGTTTTGTGAAAGGG TGGGGAGCAGAATACCGAAGGCAGACGGTAACAAGTACTCCTTGCTGGATTGAACTTCATCTGAATGGA CCTCTACAGTGGTTGGACAAAGTATTAACTCAGATGGGATCCCCTTCAGTGCGTTGCTCAAGCATGTCA TAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001135937 |
| Insert Size | 1314 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001135937.2 |
| RefSeq Size | 10461 bp |
| RefSeq ORF | 1314 bp |
| Locus ID | 4087 |
| Protein Families | Cancer stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Stem cell relevant signaling - JAK/STAT signaling pathway, Stem cell relevant signaling - TGFb/BMP signaling pathway, Transcription Factors |
| Protein Pathways | Adherens junction, Cell cycle, Colorectal cancer, Pancreatic cancer, Pathways in cancer, TGF-beta signaling pathway, Wnt signaling pathway |
| MW | 49 kDa |
| Gene Summary | The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signal of the transforming growth factor (TGF)-beta, and thus regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. This protein is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. The phosphorylation induces the dissociation of this protein with SARA and the association with the family member SMAD4. The association with SMAD4 is important for the translocation of this protein into the nucleus, where it binds to target promoters and forms a transcription repressor complex with other cofactors. This protein can also be phosphorylated by activin type 1 receptor kinase, and mediates the signal from the activin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012] Transcript Variant: This variant (3, also known as SMAD2Deltaexon3) lacks an in-frame exon in the 5' coding region, compared to variant 2, resulting in an isoform (2) that is shorter than isoform 1. There are no publicly available full-length transcripts representing this variant, but it is supported by data in Taekenoshita et al. (1998; PMID: 9503010) and Yagi et al. (1999; PMID: 9873005). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC226623 | SMAD2 (Myc-DDK-tagged)-Human SMAD family member 2 (SMAD2), transcript variant 3 |
CNY 3656.00 |
|
| RC226623L1 | Lenti-ORF clone of SMAD2 (Myc-DDK-tagged)-Human SMAD family member 2 (SMAD2), transcript variant 3 |
CNY 6056.00 |
|
| RC226623L2 | Lenti-ORF clone of SMAD2 (mGFP-tagged)-Human SMAD family member 2 (SMAD2), transcript variant 3 |
CNY 5890.00 |
|
| RC226623L3 | Lenti-ORF clone of SMAD2 (Myc-DDK-tagged)-Human SMAD family member 2 (SMAD2), transcript variant 3 |
CNY 5890.00 |
|
| RC226623L4 | Lenti-ORF clone of SMAD2 (mGFP-tagged)-Human SMAD family member 2 (SMAD2), transcript variant 3 |
CNY 5890.00 |
|
| RG226623 | SMAD2 (tGFP-tagged) - Human SMAD family member 2 (SMAD2), transcript variant 3 |
CNY 4370.00 |
