MDM2 (NM_001145337) Human Untagged Clone

CAT#: SC325933

MDM2 (untagged)-Human Mdm2 p53 binding protein homolog (mouse) (MDM2), transcript variant MDM2g



  "NM_001145337" in other vectors (4)

CNY 8550.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
MDM2 mouse monoclonal antibody, clone OTI1E6 (formerly 1E6)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ACTFS; hdm2; HDMX; LSKB
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325933 representing NM_001145337.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTGCAATACCAACATGTCTGTACCTACTGATGGTGCTGTAACCACCTCACAGATTCCAGCTTCGGAA
CAAGAGACCCTGGTTAGACCAAAGCCATTGCTTTTGAAGTTATTAAAGTCTGTTGGTGCACAAAAAGAC
ACTTATACTATGAAAGAGGTTCTTTTTTATCTTGGCCAGTATATTATGACTAAACGATTATATGATGAG
AAGCAACAACATATTGTATATTGTTCAAATGATCTTCTAGGAGATTTGTTTGGCGTGCCAAGCTTCTCT
GTGAAAGAGCACAGGAAAATATATACCATGATCTACAGGAACTTGGTAGTAGTCAATCAGCAGGAATCA
TCGGACTCAGGTACATCTGTGAGTGAGAACAGGTGTCACCTTGAAGGTGGGAGTGATCAAAAGGACCTT
GTACAAGAGCTTCAGGAAGAGAAACCTTCATCTTCACATTTGGTTTCTAGACCATCTACCTCATCTAGA
AGGAGAGCAATTAGTGAGACAGAAGAAAATTCAGATGAATTATCTGGTGAACGACAAAGAAAACGCCAC
AAATCTGATAGTATTTCCCTTTCCTTTGATGAAAGCCTGGCTCTGTGTGTAATAAGGGAGATATGTTGT
GAAAGAAGCAGTAGCAGTGAATCTACAGGGACGCCATCGAATCCGGATCTTGATGCTGGTGTATATCAA
GTTACTGTGTATCAGGCAGGGGAGAGTGATACAGATTCATTTGAAGAAGATCCTGAAATTTCCTTAGCT
GACTATTGGAAATGCACTTCATGCAATGAAATGAATCCCCCCCTTCCATCACATTGCAACAGATGTTGG
GCCCTTCGTGAGAATTGGCTTCCTGAAGATAAAGGGAAAGATAAAGGGGAAATCTCTGAGAAAGCCAAA
CTGGAAAACTCAACACAAGCTGAAGAGGGCTTTGATGTTCCTGATTGTAAAAAAACTATAGTGAATGAT
TCCAGAGAGTCATGTGTTGAGGAAAATGATGATAAAATTACACAAGCTTCACAATCACAAGAAAGTGAA
GACTATTCTCAGCCATCAACTTCTAGTAGCATTATTTATAGCAGCCAAGAAGATGTGAAAGAGTTTGAA
AGGGAAGAAACCCAAGACAAAGAAGAGAGTGTGGAATCTAGTTTGCCCCTTAATGCCATTGAACCTTGT
GTGATTTGTCAAGGTCGACCTAAAAATGGTTGCATTGTCCATGGCAAAACAGGACATCTTATGGCCTGC
TTTACATGTGCAAAGAAGCTAAAGAAAAGGAATAAGCCCTGCCCAGTATGTAGACAACCAATTCAAATG
ATTGTGCTAACTTATTTCCCCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001145337
Insert Size 1335 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001145337.2
RefSeq Size 7104 bp
RefSeq ORF 1335 bp
Locus ID 4193
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Bladder cancer, Cell cycle, Chronic myeloid leukemia, Endocytosis, Glioma, Melanoma, p53 signaling pathway, Pathways in cancer, Prostate cancer, Ubiquitin mediated proteolysis
MW 49.9 kDa
Gene Summary This gene encodes a nuclear-localized E3 ubiquitin ligase. The encoded protein can promote tumor formation by targeting tumor suppressor proteins, such as p53, for proteasomal degradation. This gene is itself transcriptionally-regulated by p53. Overexpression or amplification of this locus is detected in a variety of different cancers. There is a pseudogene for this gene on chromosome 2. Alternative splicing results in a multitude of transcript variants, many of which may be expressed only in tumor cells. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (3, also known as P2-MDM2-10) contains multiple differences in the 5' UTR and coding region, compared to variant 1. It uses an alternate promoter and initiates translation at a downstream in-frame start codon. The encoded isoform (g) has a shorter N-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...