GATA2 (NM_001145661) Human Untagged Clone
CAT#: SC326484
GATA2 (untagged)-Human GATA binding protein 2 (GATA2), transcript variant 1, mRNA
CNY 5488.00
| Cited in 2 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DCML; IMD21; MONOMAC; NFE1B |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001145661 edited
ATGGAGGTGGCGCCCGAGCAGCCGCGCTGGATGGCGCACCCGGCCGTGCTGAATGCGCAG CACCCCGACTCACACCACCCGGGCCTGGCGCACAACTACATGGAACCCGCGCAGCTGCTG CCTCCAGACGAGGTGGACGTCTTCTTCAATCACCTCGACTCGCAGGGCAACCCCTACTAT GCCAACCCCGCTCACGCGCGGGCGCGCGTCTCCTACAGCCCCGCGCACGCCCGCCTGACC GGAGGCCAGATGTGCCGCCCACACTTGTTGCACAGCCCGGGTTTGCCCTGGCTGGACGGG GGCAAAGCAGCCCTCTCTGCCGCTGCGGCCCACCACCACAACCCCTGGACCGTGAGCCCC TTCTCCAAGACGCCACTGCACCCCTCAGCTGCTGGAGGCCCTGGAGGCCCACTCTCTGTG TACCCAGGGGCTGGGGGTGGGAGCGGGGGAGGCAGCGGGAGCTCAGTGGCCTCCCTCACC CCTACAGCAGCCCACTCTGGCTCCCACCTTTTCGGCTTCCCACCCACGCCACCCAAAGAA GTGTCTCCTGACCCTAGCACCACGGGGGCTGCGTCTCCAGCCTCATCTTCCGCGGGGGGT AGTGCAGCCCGAGGAGAGGACAAGGACGGCGTCAAGTACCAGGTGTCACTGACGGAGAGC ATGAAGATGGAAAGTGGCAGTCCCCTGCGCCCAGGCCTAGCTACTATGGGCACCCAGCCT GCTACACACCACCCCATCCCCACCTACGCCTCCTATGTGCCGGCGGCTGCCCACGACTAC AGCAGCGGACTCTTCCACCCCGGAGGCTTCCTGGGGGGACCGGCCTCCAGCTTCACCCCT AAGCAGCGCAGCAAGGCTCGTTCCTGTTCAGAAGGCCGGGAGTGTGTCAACTGTGGGGCC ACAGCCACCCCTCTCTGGCGGCGGGACGGCACCGGCCACTACCTGTGCAATGCCTGTGGC CTCTACCACAAGATGAATGGGCAGAACCGACCACTCATCAAGCCCAAGCGAAGACTGTCG GCCGCCAGAAGAGCCGGCACCTGTTGTGCAAATTGTCAGACGACAACCACCACCTTATGG CGCCGAAACGCCAACGGGGACCCTGTCTGCAACGCCTGTGGCCTCTACTACAAGCTGCAC AATGTTAACAGGCCACTGACCATGAAGAAGGAAGGGATCCAGACTCGGAACCGGAAGATG TCCAACAAGTCCAAGAAGAGCAAGAAAGGGGCGGAGTGCTTCGAGGAGCTGTCAAAGTGC ATGCAGGAGAAGTCATCCCCCTTCAGTGCAGCTGCCCTGGCTGGACACATGGCACCTGTG GGCCACCTCCCGCCCTTCAGCCACTCCGGACACATCCTGCCCACTCCGACGCCCATCCAC CCCTCCTCCAGCCTCTCCTTCGGCCACCCCCACCCGTCCAGCATGGTGACCGCCATGGGC TAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001145661 |
| Insert Size | 3300 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001145661.1, NP_001139133.1 |
| RefSeq Size | 3484 bp |
| RefSeq ORF | 1443 bp |
| Locus ID | 2624 |
| UniProt ID | P23769 |
| Protein Families | Adult stem cells, Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors |
| Gene Summary | This gene encodes a member of the GATA family of zinc-finger transcription factors that are named for the consensus nucleotide sequence they bind in the promoter regions of target genes. The encoded protein plays an essential role in regulating transcription of genes involved in the development and proliferation of hematopoietic and endocrine cell lineages. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009] Transcript Variant: This variant (1) represents the longest transcript. Both variants 1 and 2 encode the same isoform (1). |
Citations (2)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Differential effects on gene transcription and hematopoietic differentiation correlate with GATA2 mutant disease phenotypes
,Chong, CE;Venugopal, P;Stokes, PH;Lee, YK;Brautigan, PJ;Yeung, DTO;Babic, M;Engler, GA;Lane, SW;Klingler-Hoffmann, M;Matthews, JM;D'Andrea, RJ;Brown, AL;Hahn, CN;Scott, HS;,
Leukemia
,PubMed ID 28642594
[GATA2]
|
|
Post-genome wide association studies and functional analyses identify association of MPP7 gene variants with site-specific bone mineral density
,Su-Mei Xiao, Annie Wai Chee Kung, Yi Gao, Kam-Shing Lau, Alvin Ma, Zhen-Lin Zhang, Jian-Min Liu, Wiebo Xia, Jin-Wei He, Lin Zhao, Min Nie, Wei-Zhen Fu, Min-Jia Zhang, Jing Sun, Johnny S.H. Kwan, Gloria Hoi Wan Tso, Zhi-Jie Dai, Ching-Lung Cheung, Cora H. Bow, Anskar Yu Hung Leung, Kathryn Choon Beng Tan, and Pak Chung Sham,
Hum. Mol. Genet., Jan 2012; 10.1093/hmg/ddr586.
[GATA2]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227363 | GATA2 (Myc-DDK-tagged)-Human GATA binding protein 2 (GATA2), transcript variant 1 |
CNY 5488.00 |
|
| RC227363L1 | Lenti ORF clone of Human GATA binding protein 2 (GATA2), transcript variant 1, Myc-DDK-tagged |
CNY 7888.00 |
|
| RC227363L2 | Lenti ORF clone of Human GATA binding protein 2 (GATA2), transcript variant 1, mGFP tagged |
CNY 7888.00 |
|
| RC227363L3 | Lenti ORF clone of Human GATA binding protein 2 (GATA2), transcript variant 1, Myc-DDK-tagged |
CNY 7888.00 |
|
| RC227363L4 | Lenti ORF clone of Human GATA binding protein 2 (GATA2), transcript variant 1, mGFP tagged |
CNY 7888.00 |
|
| RG227363 | GATA2 (tGFP-tagged) - Human GATA binding protein 2 (GATA2), transcript variant 1 |
CNY 7088.00 |
