Aph 1b (APH1B) (NM_001145646) Human Untagged Clone
CAT#: SC326540
APH1B (untagged)-Human anterior pharynx defective 1 homolog B (C. elegans) (APH1B), transcript variant 2, mRNA
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | APH-1B; PRO1328; PSFL; TAAV688 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC326540 representing NM_001145646.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACTGCGGCCGTGTTCTTCGGCTGCGCCTTCATTGCCTTCGGGCCTGCGCTCGCCCTTTATGTCTTC ACCATCGCCACCGAGCCGTTGCGTATCATCTTCCTCATCGCCGGAGCTTTCTTCTGGTTGGTGTCTCTA CTGATTTCGTCCCTTGTTTGGTTCATGGCAAGAGTCATTATTGACAACAAAGATGGACCAACACAGAAA TATCTGCTGATCTTTGGAGCGTTTGTCTCTGTCTATATCCAAGAAATGTTCCGATTTGCATATTATAAA CTCTTAAAAAAAGCCAGTGAAGGTTTGAAGAGTATAAACCCAGGTGAGACAGCACCCTCTATGCGACTG CTGGCCTATGCTTTCATGACGCTGGTCATTATCTTGCTGCATGTATTCTGGGGCATTGTATTTTTTGAT GGCTGTGAGAAGAAAAAGTGGGGCATCCTCCTTATCGTTCTCCTGACCCACCTGCTGGTGTCAGCCCAG ACCTTCATAAGTTCTTATTATGGAATAAACCTGGCGTCAGCATTTATAATCCTGGTGCTCATGGGCACC TGGGCATTCTTAGCTGCGGGAGGCAGCTGCCGAAGCCTGAAACTCTGCCTGCTCTGCCAAGACAAGAAC TTTCTTCTTTACAACCAGCGCTCCAGATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001145646 |
Insert Size | 651 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001145646.1 |
RefSeq Size | 4082 bp |
RefSeq ORF | 651 bp |
Locus ID | 83464 |
UniProt ID | Q8WW43 |
Protein Families | Transmembrane |
MW | 24.3 kDa |
Gene Summary | This gene encodes a multi-pass transmembrane protein that is a functional component of the gamma-secretase complex, which also contains presenilin and nicastrin. This protein represents a stabilizing cofactor for the presenilin holoprotein in the complex. The gamma-secretase complex catalyzes the cleavage of integral proteins such as notch receptors and beta-amyloid precursor protein. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (2) lacks an in-frame coding exon and encodes a shorter isoform (2), as compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226500 | APH1B (Myc-DDK-tagged)-Human anterior pharynx defective 1 homolog B (C. elegans) (APH1B), transcript variant 2 |
CNY 2400.00 |
|
RC226500L3 | Lenti ORF clone of Human anterior pharynx defective 1 homolog B (C. elegans) (APH1B), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC226500L4 | Lenti ORF clone of Human anterior pharynx defective 1 homolog B (C. elegans) (APH1B), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG226500 | APH1B (tGFP-tagged) - Human anterior pharynx defective 1 homolog B (C. elegans) (APH1B), transcript variant 2 |
CNY 4370.00 |