MEF2B (NM_001145785) Human Untagged Clone

CAT#: SC326564

MEF2B (untagged)-Human myocyte enhancer factor 2B (MEF2B), mRNA



  "NM_001145785" in other vectors (4)

CNY 5488.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
Rabbit polyclonal anti-MEF2B antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RSRFR2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001145785, the custom clone sequence may differ by one or more nucleotides


ATGGGGAGGAAAAAAATCCAGATCTCCCGCATCCTGGACCAAAGGAATCGGCAGGTGACGTTCACCAAGC
GGAAGTTCGGGCTGATGAAGAAGGCCTATGAGCTGAGCGTGCTCTGTGACTGTGAGATAGCCCTCATCAT
CTTCAACAGCGCCAACCGCCTCTTCCAGTATGCCAGCACGGACATGGACCGTGTGCTGCTGAAGTACACA
GAGTACAGCGAGCCCCACGAGAGCCGCACCAACACTGACATCCTCGAGACGCTGAAGCGGAGGGGCATTG
GCCTCGATGGGCCAGAGCTGGAGCCGGATGAAGGGCCTGAGGAGCCAGGAGAGAAGTTTCGGAGGCTGGC
AGGCGAAGGGGGTGATCCGGCCTTGCCCCGACCCCGGCTGTATCCTGCAGCTCCTGCTATGCCCAGCCCA
GATGTGGTATACGGGGCCTTACCGCCACCAGGCTGTGACCCCAGTGGGCTTGGGGAAGCACTGCCCGCCC
AGAGCCGCCCATCTCCCTTCCGACCAGCAGCCCCCAAAGCCGGGCCCCCAGGCCTGGTGCACCCTCTCTT
CTCACCAAGCCACCTCACCAGCAAGACACCACCCCCACTGTACCTGCCGACGGAAGGGCGGAGGTCAGAC
CTGCCTGGTGGCCTGGCTGGGCCCCGAGGGGGACTAAACACCTCCAGAAGCCTCTACAGTGGCCTGCAGA
ACCCCTGCTCCACTGCAACTCCCGGACCCCCACTGGGGAGCTTCCCCTTCCTCCCCGGAGGCCCCCCAGA
ATATGGCCTGGGAGACCCTCCACCGCCCCCTGGCTTGTTGCAGCCCCCCACCCTGGCCCCCTGGCAGCCC
TCGAGGGGTGATGGGCCCCCCGCCGTGTCCTCCCAGCCCAGTGGGGGCCGAAGCCTGGGCGAGGAGGGTC
CCCCAACCCGCGGCGCCTCCCCGCCGACCCCCCCAGTCAGCATCAAGTCTGAGCGCCTCTCTCCGGCCCC
CGGGGGCCCCGGCGACTTTCCTAAGACCTTCCCCTATCCCTTGCTCCTCGCCCGGTCCCTGGCAGAGCCT
CTGCGGCCTGGGCCCGCCCTGCGCCGGCTGCCCTTGGCCGACGGCTGGCCCCGGTAG


Restriction Sites Please inquire     
ACCN NM_001145785
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001145785.1, NP_001139257.1
RefSeq Size 1472 bp
RefSeq ORF 1107 bp
Locus ID 100271849
UniProt ID Q02080
Gene Summary The product of this gene is a member of the MADS/MEF2 family of DNA binding proteins. The protein is thought to regulate gene expression, including expression of the smooth muscle myosin heavy chain gene. This region undergoes considerable alternative splicing, with transcripts supporting two non-overlapping loci (GeneID 729991 and 100271849) as well as numerous read-through transcripts that span both loci (annotated as GeneID 4207). Several isoforms of this protein are expressed from either this locus or from some of the read-through transcripts annotated on GeneID 4207. [provided by RefSeq, Jan 2014]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...