hnRNP G (RBMX) (NM_001164803) Human Untagged Clone
CAT＃: SC326763
RBMX (untagged)-Human RNA binding motif protein X-linked (RBMX) transcript variant 2
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | hnRNP-G; HNRNPG; HNRPG; MRXS11; RBMXP1; RBMXRT; RNMX |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001164803, the custom clone sequence may differ by one or more nucleotides
ATGGTTGAAGCAGATCGCCCAGGAAAGCTCTTCATTGGTGGGCTTAATACGGAAACAAAT GAGAAAGCTCTTGAAGCAGTATTTGGCAAATATGGACGAATAGTGGAAGTACTCTTGATG AAAGACCGTGAAACCAACAAATCAAGAGGATTTGCTTTTGTCACCTTTGAAAGCCCAGCA GACGCTAAGGATGCAGCCAGAGACATGAATGGAAAGCTCCTGTATCACGTGGAAGAGATA GTTATGGAGGTCCACCTCGAAGGGAACCGCTGCCCTCTCGTAGAGATGTTTATTTGTCCC CAAGAGATGATGGGTATTCTACTAAAGACAGCTATTCAAGCAGAGATTACCCAAGTTCTC GTGATACTAGAGATTATGCACCACCACCACGAGATTATACTTACCGTGATTATGGTCATT CCAGTTCACGTGATGACTATCCATCAAGAGGATATAGCGATAGAGATGGATATGGTCGTG ATCGTGACTATTCAGATCATCCAAGTGGAGGTTCCTACAGAGATTCATATGAGAGTTATG GTTGGTGATTTTGCTCATTATGGTCGTGGAGTGCTGATTGATTCACAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001164803 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001164803.1, NP_001158275.1 |
| RefSeq Size | 2071 bp |
| RefSeq ORF | 591 bp |
| Locus ID | 27316 |
| UniProt ID | P38159 |
| Protein Pathways | Spliceosome |
| Gene Summary | This gene belongs to the RBMY gene family which includes candidate Y chromosome spermatogenesis genes. This gene, an active X chromosome homolog of the Y chromosome RBMY gene, is widely expressed whereas the RBMY gene evolved a male-specific function in spermatogenesis. Pseudogenes of this gene, found on chromosomes 1, 4, 9, 11, and 6, were likely derived by retrotransposition from the original gene. Alternatively spliced transcript variants encoding different isoforms have been identified. A snoRNA gene (SNORD61) is found in one of its introns. [provided by RefSeq, Sep 2009] Transcript Variant: This variant (2) lacks several alternate exon and contains a different 3' end, compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct C-terminus when it is compared to variant 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228128 | RBMX (Myc-DDK-tagged)-Human RNA binding motif protein, X-linked (RBMX), transcript variant 2 |
CNY 2400.00 |
|
| RC228128L3 | Lenti-ORF clone of RBMX (Myc-DDK-tagged)-Human RNA binding motif protein, X-linked (RBMX), transcript variant 2 |
CNY 5890.00 |
|
| RC228128L4 | Lenti-ORF clone of RBMX (mGFP-tagged)-Human RNA binding motif protein, X-linked (RBMX), transcript variant 2 |
CNY 5890.00 |
|
| RG228128 | RBMX (tGFP-tagged) - Human RNA binding motif protein, X-linked (RBMX), transcript variant 2 |
CNY 4370.00 |
其它hnRNP G产品
