ETS1 (NM_001162422) Human Untagged Clone

CAT#: SC326792

ETS1 (untagged)-Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1) transcript variant 3



  "NM_001162422" in other vectors (6)

CNY 3600.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ETS1 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms c-ets-1; ETS-1; EWSR2; p54
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC326792 representing NM_001162422
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGGCGGCCGTCGATCTCAAGCCGACTCTCACCATCATCAAGACGGAAAAAGTCGATCTGGAGCTTT
TCCCCTCCCCGGGTAAACTCGGGGGCCAGGACTCTTTTGAAAGCATAGAGAGCTACGATAGTTGTGATCG
CCTCACCCAGTCCTGGAGCAGCCAGTCATCTTTCAACAGCCTGCAGCGTGTTCCCTCCTATGACAGCTTC
GACTCAGAGGACTATCCGGCTGCCCTGCCCAACCACAAGCCCAAGGGCACCTTCAAGGACTATGTGCGGG
ACCGTGCTGACCTCAATAAGGACAAGCCTGTCATTCCTGCTGCTGCCCTAGCTGGCTACACAGGCAGTGG
ACCAATCCAGCTGTGGCAGTTTCTTCTGGAATTACTCACTGATAAATCCTGTCAGTCTTTTATCAGCTGG
ACAGGAGATGGCTGGGAATTCAAACTTTCTGACCCAGATGAGGTGGCCAGGAGATGGGGAAAGAGGAAAA
ACAAACCTAAGATGAATTATGAGAAACTGAGCCGTGGCCTACGCTACTATTACGACAAAAACATCATCCA
CAAGACAGCGGGGAAACGCTACGTGTACCGCTTTGTGTGTGACCTGCAGAGCCTGCTGGGGTACACCCCT
GAGGAGCTGCACGCCATGCTGGACGTCAAGCCAGATGCCGACGAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites Please inquire     
ACCN NM_001162422
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001162422.1, NP_001155894.1
RefSeq Size 4594 bp
RefSeq ORF 678 bp
Locus ID 2113
UniProt ID P14921
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Dorso-ventral axis formation, Pathways in cancer, Renal cell carcinoma
Gene Summary This gene encodes a member of the ETS family of transcription factors, which are defined by the presence of a conserved ETS DNA-binding domain that recognizes the core consensus DNA sequence GGAA/T in target genes. These proteins function either as transcriptional activators or repressors of numerous genes, and are involved in stem cell development, cell senescence and death, and tumorigenesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
Transcript Variant: This variant (3) uses an alternate promoter, and differs in the 5' UTR and 5' coding region compared to variant 1. It is also missing four consecutive in-frame coding exons, resulting in a shorter isoform (3, also known as Ets-1 p27) with a distinct N-terminus and lacking an internal protein segment compared to isoform 1. This isoform has been shown to exert a dominant negative effect on the transcriptional properties and the subcellular localization of Ets-1 p51 isoform (PMID:19377509). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...