KLF6 (NM_001160125) Human Untagged Clone
CAT#: SC326802
KLF6 (untagged)-Human Kruppel-like factor 6 (KLF6) transcript variant C
CNY 3600.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BCD1; CBA1; COPEB; CPBP; GBF; PAC1; ST12; ZF9 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001160125, the custom clone sequence may differ by one or more nucleotides
ATGGACGTGCTCCCCATGTGCAGCATCTTCCAGGAGCTCCAGATCGTGCACGAGACCGGCTACTTCTCGG CGCTGCCGTCTCTGGAGGAGTACTGGCAACAGACCTGCCTAGAGCTGGAACGTTACCTCCAGAGCGAGCC CTGCTATGTTTCAGCCTCAGAAATCAAATTTGACAGCCAGGAAGATCTGTGGACCAAAATCATTCTGGCT CGGGAGAAAAAGGAGGAATCCGAACTGAAGATATCTTCCAGTCCTCCAGAGGACACTCTCATCAGCCCGA GCTTTTGTTACAACTTAGAGACCAACAGCCTGAACTCAGATGTCAGCAGCGAATCCTCTGACAGCTCCGA GGAACTTTCTCCCACGGCCAAGTTTACCTCCGACCCCATTGGCGAAGTTTTGGTCAGCTCGGGAAAATTG AGCTCCTCTGTCACCTCCACGCCTCCATCTTCTCCGGAACTGAGCAGGGAACCTTCTCAACTGTGGGGTT GCGTGCCCGGGGAGCTGCCCTCGCCAGGGAAGGTGCGCAGCGGGACTTCGGGGAAGCCAGGTGACAAGGG AAATGGCGATGCCTCCCCCGACGGCAGGAGGAGGGTGCACCGGTGCCACTTTAACGGCTGCAGGAAAGTT TACACCAAAAGCTCCCACTTGAAAGCACACCAGCGGACGCACACAGGTGTTTTTCCAGGTCTGACCACCT GGCCCTGCACATGA |
Restriction Sites | Please inquire |
ACCN | NM_001160125 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001160125.1, NP_001153597.1 |
RefSeq Size | 4555 bp |
RefSeq ORF | 714 bp |
Locus ID | 1316 |
UniProt ID | Q99612 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors |
Gene Summary | This gene encodes a member of the Kruppel-like family of transcription factors. The zinc finger protein is a transcriptional activator, and functions as a tumor suppressor. Multiple transcript variants encoding different isoforms have been found for this gene, some of which are implicated in carcinogenesis. [provided by RefSeq, May 2009] Transcript Variant: This variant (C), also known as sv3, lacks an alternate exon in the 3' coding region that results in a frameshift, compared to variant A. The resulting isoform (C) has a shorter and distinct C-terminus, compared to isoform A. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228167 | KLF6 (Myc-DDK-tagged)-Human Kruppel-like factor 6 (KLF6), transcript variant C |
CNY 3600.00 |
|
RC228167L3 | Lenti ORF clone of Human Kruppel-like factor 6 (KLF6), transcript variant C, Myc-DDK-tagged |
CNY 5890.00 |
|
RC228167L4 | Lenti ORF clone of Human Kruppel-like factor 6 (KLF6), transcript variant C, mGFP tagged |
CNY 5890.00 |
|
RG228167 | KLF6 (tGFP-tagged) - Human Kruppel-like factor 6 (KLF6), transcript variant C |
CNY 4370.00 |