LDHA (NM_001165416) Human Untagged Clone
CAT#: SC326810
LDHA (untagged)-Human lactate dehydrogenase A (LDHA) transcript variant 5
CNY 3990.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GSD11; HEL-S-133P; LDHM; PIG19 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001165416, the custom clone sequence may differ by one or more nucleotides
ATGGCAACTCTAAAGGATCAGCTGATTTATAATCTTCTAAAGGAAGAACAGACCCCCCAG AATAAGATTACAGTTGTTGGGGTTGGTGCTGTTGGCATGGCCTGTGCCATCAGTATCTTA ATGAAGGACTTGGCAGATGAACTTGCTCTTGTTGATGTCATCGAAGACAAATTGAAGGGA GAGATGATGGATCTCCAACATGGCAGCCTTTTCCTTAGAACACCAAAGATTGTCTCTGGC AAAGACTATAATGTAACTGCAAACTCCAAGCTGGTCATTATCACGGCTGGGGCACGTCAG CAAGAGGGAGAAAGCCGTCTTAATTTGGTCCAGCGTAACGTGAACATCTTTAAATTCATC ATTCCTAATGTTGTAAAATACAGCCCGAACTGCAAGTTGCTTATTGTTTCAAATCCAGTG GATATCTTGACCTACGTGGCTTGGAAGATAAGTGGTTTTCCCAAAAACCGTGTTATTGGA AGCGGTTGCAATCTGGATTCAGCCCGATTCCGTTACCTAATGGGGGAAAGGCTGGGAGTT CACCCATTAAGCTGTCATGGGTGGGTCCTTGGGGAACATGGAGATTCCAGTGTGCCTGTA TGGAGTGGAATGAATGTTGCTGGTGTCTCTCTGAAGACTCTGCACCCAGATTTAGGGACT GATAAAGATAAGGAACAGTGGAAAGAGGTTCACAAGCAGGTGGTTGAGAGGGTCTTTACG GAA |
Restriction Sites | Please inquire |
ACCN | NM_001165416 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001165416.1, NP_001158888.1 |
RefSeq Size | 2102 bp |
RefSeq ORF | 726 bp |
Locus ID | 3939 |
UniProt ID | P00338 |
Protein Families | Druggable Genome |
Protein Pathways | Cysteine and methionine metabolism, Glycolysis / Gluconeogenesis, Metabolic pathways, Propanoate metabolism, Pyruvate metabolism |
Gene Summary | The protein encoded by this gene catalyzes the conversion of L-lactate and NAD to pyruvate and NADH in the final step of anaerobic glycolysis. The protein is found predominantly in muscle tissue and belongs to the lactate dehydrogenase family. Mutations in this gene have been linked to exertional myoglobinuria. Multiple transcript variants encoding different isoforms have been found for this gene. The human genome contains several non-transcribed pseudogenes of this gene. [provided by RefSeq, Sep 2008] Transcript Variant: This variant (5) lacks an alternate exon in the 3' coding region, compared to variant 1, which results in a frameshift. The resulting isoform (5) lacks a segment of the LDH domain and has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228175 | LDHA (Myc-DDK-tagged)-Human lactate dehydrogenase A (LDHA), transcript variant 5 |
CNY 3990.00 |
|
RC228175L3 | Lenti-ORF clone of LDHA (Myc-DDK-tagged)-Human lactate dehydrogenase A (LDHA), transcript variant 5 |
CNY 5890.00 |
|
RC228175L4 | Lenti-ORF clone of LDHA (mGFP-tagged)-Human lactate dehydrogenase A (LDHA), transcript variant 5 |
CNY 5890.00 |
|
RG228175 | LDHA (tGFP-tagged) - Human lactate dehydrogenase A (LDHA), transcript variant 5 |
CNY 4240.00 |