RASSF8 (NM_001164748) Human Untagged Clone
CAT#: SC326968
RASSF8 (untagged)-Human Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 (RASSF8) transcript variant 3
CNY 6750.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C12orf2; HOJ1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001164748, the custom clone sequence may differ by one or more nucleotides
ATGGAACTTAAAGTATGGGTGGATGGAGTTCAGAGGATTGTTTGTGGAGTCACTGAAGTC ACAACTTGCCAGGAGGTTGTCATAGCCTTAGCTCAAGCAATAGGTCGAACTGGAAGGTAC ACCCTTATAGAGAAATGGAGAGATACTGAAAGACACTTAGCACCTCATGAAAATCCTATC ATATCCTTAAACAAATGGGGGCAGTATGCTAGTGATGTGCAGCTCATTCTACGACGAACT GGGCCGTCTCTCAGTGAGCGACCCACTTCAGACAGTGTGGCTCGAATTCCTGAAAGAACT TTATACAGGCAGAGTCTGCCCCCCTTAGCTAAACTGAGGCCTCAGATTGACAAATCAATC AAAAGGAGGGAACCGAAAAGGAAATCACTGACATTTACAGGAGGTGCCAAAGGATTAATG GACATTTTTGGAAAAGGTAAAGAAACTGAGTTTAAGCAAAAGGTGCTGAATAACTGCAAA ACAACAGCAGATGAGTTGAAGAAGCTAATCCGTCTGCAGACAGAGAAGCTTCAATCCATT GAGAAACAGCTGGAATCTAATGAAATAGAAATAAGATTTTGGGAGCAAAAGTATAATTCC AACCTTGAAGAGGAAATTGTCCGTCTAGAGCAAAAGATCAAAAGAAACGATGTAGAAATT GAGGAGGAAGAATTCTGGGAAAATGAATTACAGATTGAACAGGAAAATGAAAAACAGCTG AAGGATCAACTTCAAGAAATAAGACAGAAAATAACAGAATGTGAAAACAAATTAAAGGAC TATTTGGCACAGATCCGGACTATGGAAAGTGGTCTTGAAGCAGAAAAATTGCAACGGGAA GTTCAAGAGGCACAGGTCAATGAGGAAGAGGTTAAAGGAAAGATCGGTAAGGTCAAAGGG GAGATTGACATTCAAGGCCAGCAGAGTCTGAGGTTGGAAAATGGCATCAAAGCTGTGGAA AGATCTCTTGGACAAGCCACCAAACGCTTACAGGACAAAGAACAGGAACTGGAGCAGTTG ACTAAGGAGTTGCGGCAAGTCAATCTCCAGCAGTTCATCCAGCAGACAGGGACAAAAGTT ACCGTTTTGCCAGCGGAGCCCATTGAAATAGAGGCCTCACATGCAGACATTGAAAGGGAG GCACCATTCCAGTCTGGGTCCCTGAAGCGACCTGGTTCATCTCGGCAGCTCCCCAGTAAT CTCCGCATTCTGCAGAATCCTATCTCATCTGGTTTTAATCCTGAAGGCATATATGTA |
| Restriction Sites | Please inquire |
| ACCN | NM_001164748 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001164748.1, NP_001158220.1 |
| RefSeq Size | 5561 bp |
| RefSeq ORF | 1260 bp |
| Locus ID | 11228 |
| UniProt ID | Q8NHQ8 |
| Gene Summary | This gene encodes a member of the Ras-assocation domain family (RASSF) of tumor suppressor proteins. This gene is essential for maintaining adherens junction function in epithelial cells and has a role in epithelial cell migration. It is a lung tumor suppressor gene candidate. A chromosomal translocation t(12;22)(p11.2;q13.3) leading to the fusion of this gene and the FBLN1 gene is found in a complex type of synpolydactyly. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011] Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228333 | RASSF8 (Myc-DDK-tagged)-Human Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 (RASSF8), transcript variant 3 |
CNY 3656.00 |
|
| RC228333L3 | Lenti-ORF clone of RASSF8 (Myc-DDK-tagged)-Human Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 (RASSF8), transcript variant 3 |
CNY 5890.00 |
|
| RC228333L4 | Lenti-ORF clone of RASSF8 (mGFP-tagged)-Human Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 (RASSF8), transcript variant 3 |
CNY 5890.00 |
|
| RG228333 | RASSF8 (tGFP-tagged) - Human Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 (RASSF8), transcript variant 3 |
CNY 4370.00 |
