PDP1 (NM_001161779) Human Untagged Clone
CAT#: SC327091
PDP1 (untagged)-Human pyruvate dehyrogenase phosphatase catalytic subunit 1 (PDP1) nuclear gene encoding mitochondrial protein transcript variant 2
CNY 9030.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PDH; PDP; PDPC; PPM2A; PPM2C |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001161779, the custom clone sequence may differ by one or more nucleotides
ATGTGTGTGTGTCCCGGGCCCAGACGAATTGGAATCCCAGTCAGAAGTTCCAGCCTGCCA CTGTTCTCTGATGCCATGCCAGCACCAACTCAACTGTTTTTTCCTCTCATCCGTAACTGT GAACTGAGCAGGATCTATGGCACTGCATGTTACTGCCACCACAAACATCTCTGTTGTTCC TCATCGTACATTCCTCAGAGTCGACTGAGATACACACCTCATCCAGCATATGCTACCTTT TGCAGGCCAAAGGAGAACTGGTGGCAGTACACCCAAGGAAGGAGATATGCTTCCACACCA CAGAAATTTTACCTCACACCTCCACAAGTCAATAGCATCCTTAAAGCTAATGAATACAGT TTCAAAGTGCCAGAATTTGACGGCAAAAATGTCAGTTCTATCCTTGGATTTGACAGCAAT CAGCTGCCTGCAAATGCACCCATTGAGGACCGGAGAAGTGCAGCAACCTGCTTGCAGACC AGAGGGATGCTTTTGGGGGTTTTTGATGGCCATGCAGGTTGTGCTTGTTCCCAGGCAGTC AGTGAAAGACTCTTTTATTATATTGCTGTCTCTTTGTTACCCCATGAGACTTTGCTAGAG ATTGAAAATGCAGTGGAGAGCGGCCGGGCACTGCTACCCATTCTCCAGTGGCACAAGCAC CCCAATGATTACTTTAGTAAGGAGGCATCCAAATTGTACTTTAACAGCTTGAGGACTTAC TGGCAAGAGCTTATAGACCTCAACACTGGTGAGTCGACTGATATTGATGTTAAGGAGGCT CTAATTAATGCCTTCAAGAGGCTTGATAATGACATCTCCTTGGAGGCGCAAGTTGGTGAT CCTAATTCTTTTCTCAACTACCTGGTGCTTCGAGTGGCATTTTCTGGAGCCACTGCTTGT GTGGCCCATGTGGATGGTGTTGACCTTCATGTGGCCAATACTGGCGATAGCAGAGCCATG CTGGGTGTGCAGGAAGAGGACGGCTCATGGTCAGCAGTCACGCTGTCTAATGACCACAAT GCTCAAAATGAAAGAGAACTAGAACGGCTGAAATTGGAACATCCAAAGAGTGAGGCCAAG AGTGTCGTGAAACAGGATCGGCTGCTTGGCTTGCTGATGCCATTTAGGGCATTTGGAGAT GTAAAGTTCAAATGGAGCATTGACCTTCAAAAGAGAGTGATAGAATCTGGCCCAGACCAG TTGAATGACAATGAATATACCAAGTTTATTCCTCCTAATTATCACACACCTCCTTATCTC ACTGCTGAGCCAGAGGTAACTTACCACCGATTAAGGCCACAGGATAAGTTTCTGGTGTTG GCTACTGATGGGTTGTGGGAGACTATGCATAGGCAGGATGTGGTTAGGATTGTGGGTGAG TACCTAACTGGCATGCATCACCAACAGCCAATAGCTGTTGGTGGCTACAAGGTGACTCTG GGACAGATGCATGGCCTTTTAACAGAAAGGAGAACCAAAATGTCCTCGGTATTTGAGGAT CAGAACGCAGCAACCCATCTCATTCGCCACGCTGTGGGCAACAACGAGTTTGGGACTGTT GATCATGAGCGCCTCTCTAAAATGCTTAGTCTTCCTGAAGAGCTTGCTCGAATGTACAGA GATGACATTACAATCATTGTAGTTCAGTTCAATTCTCATGTTGTAGGGGCGTATCAAAAC CAAGAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001161779 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001161779.1, NP_001155251.1 |
| RefSeq Size | 4373 bp |
| RefSeq ORF | 1689 bp |
| Locus ID | 54704 |
| UniProt ID | Q9P0J1 |
| Protein Families | Druggable Genome, Phosphatase |
| Gene Summary | Pyruvate dehydrogenase (E1) is one of the three components (E1, E2, and E3) of the large pyruvate dehydrogenase complex. Pyruvate dehydrogenase kinases catalyze phosphorylation of serine residues of E1 to inactivate the E1 component and inhibit the complex. Pyruvate dehydrogenase phosphatases catalyze the dephosphorylation and activation of the E1 component to reverse the effects of pyruvate dehydrogenase kinases. Pyruvate dehydrogenase phosphatase is a heterodimer consisting of catalytic and regulatory subunits. Two catalytic subunits have been reported; one is predominantly expressed in skeletal muscle and another one is is much more abundant in the liver. The catalytic subunit, encoded by this gene, is the former, and belongs to the protein phosphatase 2C (PP2C) superfamily. Along with the pyruvate dehydrogenase complex and pyruvate dehydrogenase kinases, this enzyme is located in the mitochondrial matrix. Mutation in this gene causes pyruvate dehydrogenase phosphatase deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Jun 2009] Transcript Variant: This variant (2) is the longest transcript. This variant and variant 3 encode the same isoform (2). |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Hypoxic repression of pyruvate dehydrogenase activity is necessary for metabolic reprogramming and growth of model tumours
,Golias, T;Papandreou, I;Sun, R;Kumar, B;Brown, NV;Swanson, BJ;Pai, R;Jaitin, D;Le, QT;Teknos, TN;Denko, NC;,
Sci Rep
,PubMed ID 27498883
[PDP1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228456 | PDP1 (Myc-DDK-tagged)-Human pyruvate dehyrogenase phosphatase catalytic subunit 1 (PDP1), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 4184.00 |
|
| RC228456L3 | Lenti-ORF clone of PDP1 (Myc-DDK-tagged)-Human pyruvate dehyrogenase phosphatase catalytic subunit 1 (PDP1), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 6840.00 |
|
| RC228456L4 | Lenti-ORF clone of PDP1 (mGFP-tagged)-Human pyruvate dehyrogenase phosphatase catalytic subunit 1 (PDP1), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 6840.00 |
|
| RG228456 | PDP1 (tGFP-tagged) - Human pyruvate dehyrogenase phosphatase catalytic subunit 1 (PDP1), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5420.00 |
