EWSR1 (NM_001163287) Human Untagged Clone
CAT#: SC327475
EWSR1 (untagged)-Human Ewing sarcoma breakpoint region 1 (EWSR1) transcript variant 5
CNY 7220.00
Product images

CNY 1999.00
CNY 3490.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | bK984G1.4; EWS; EWS-FLI1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC327475 representing NM_001163287.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGTCCACGGATTACAGTACCTATAGCCAAGCTGCAGCGCAGCAGGGCTACAGTGCTTACACCGCC CAGCCCACTCAAGGATATGCACAGACCACCCAGGCATATGGGCAACAAAGCTATGGAACCTATGGACAG CCCACTGATGTCAGCTATACCCAGGCTCAGACCACTGCAACCTATGGGCAGACCGCCTATGCAACTTCT TATGGACAGCCTCCCACTGGTTATACTACTCCAACTGCCCCCCAGGCATACAGCCAGCCTGTCCAGGGG TATGGCACTGGTGCTTATGATACCACCACTGCTACAGTCACCACCACCCAGGCCTCCTATGCAGCTCAG TCTGCATATGGCACTCAGCCTGCTTATCCAGCCTATGGGCAGCAGCCAGCAGCCACTGCACCTACAAGA CCGCAGGATGGAAACAAGCCCACTGAGACTAGTCAACCTCAATCTAGCACAGGGGGTTACAACCAGCCC AGCCTAGGATATGGACAGAGTAACTACAGTTATCCCCAGGTACCTGGGAGCTACCCCATGCAGCCAGTC ACTGCACCTCCATCCTACCCTCCTACCAGCTATTCCTCTACACAGCCGACTAGTTATGATCAGAGCAGT TACTCTCAGCAGAACACCTATGGGCAACCGAGCAGCTATGGACAGCAGAGTAGCTATGGTCAACAAAGC AGCTATGGGCAGCAGCCTCCCACTAGTTACCCACCCCAAACTGGATCCTACAGCCAAGCTCCAAGTCAA TATAGCCAACAGAGCAGCAGCTACGGGCAGCAGAGTTCATTCCGACAGGACCACCCCAGTAGCATGGGT GTTTATGGGCAGGAGTCTGGAGGATTTTCCGGACCAGGAGAGAACCGGAGCATGAGTGGCCCTGATAAC CGGGGCAGGGGAAGAGGGGGATTTGATCGTGGAGGCATGAGCAGAGGTGGGCGGGGAGGAGGACGCGGT GGAATGGGGTTACAAAGTGAGAGCCTTGTATACACTTCAATACTTAAAAAGTACCCGTACTCAGTACTC AGCCGGCAGCATAATGAAAAGTGGGACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001163287 |
Insert Size | 1065 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001163287.1 |
RefSeq Size | 1591 bp |
RefSeq ORF | 1065 bp |
Locus ID | 2130 |
UniProt ID | Q01844 |
Protein Families | Druggable Genome, Stem cell - Pluripotency, Transcription Factors |
MW | 37.6 kDa |
Gene Summary | This gene encodes a multifunctional protein that is involved in various cellular processes, including gene expression, cell signaling, and RNA processing and transport. The protein includes an N-terminal transcriptional activation domain and a C-terminal RNA-binding domain. Chromosomal translocations between this gene and various genes encoding transcription factors result in the production of chimeric proteins that are involved in tumorigenesis. These chimeric proteins usually consist of the N-terminal transcriptional activation domain of this protein fused to the C-terminal DNA-binding domain of the transcription factor protein. Mutations in this gene, specifically a t(11;22)(q24;q12) translocation, are known to cause Ewing sarcoma as well as neuroectodermal and various other tumors. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1 and 14. [provided by RefSeq, Jul 2009] Transcript Variant: This variant (5) lacks an alternate in-frame exon in the 5' coding region, and differs in the 3' UTR and in the presence and absence of exons in the 3' coding region, compared to variant 1. The resulting isoform (5) has a distinct C-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC228840 | EWSR1 (Myc-DDK-tagged)-Human Ewing sarcoma breakpoint region 1 (EWSR1), transcript variant 5 |
CNY 3656.00 |
|
RC228840L3 | Lenti ORF clone of Human Ewing sarcoma breakpoint region 1 (EWSR1), transcript variant 5, Myc-DDK-tagged |
CNY 5890.00 |
|
RC228840L4 | Lenti ORF clone of Human Ewing sarcoma breakpoint region 1 (EWSR1), transcript variant 5, mGFP tagged |
CNY 5890.00 |
|
RG228840 | EWSR1 (tGFP-tagged) - Human Ewing sarcoma breakpoint region 1 (EWSR1), transcript variant 5 |
CNY 4370.00 |