DIO3 (NM_001362) Human Untagged Clone
CAT#: SC327784
DIO3 (untagged)-Human deiodinase iodothyronine type III (DIO3) (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Synonyms | 5DIII; D3; DIOIII; TXDI3 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC327784 representing NM_001362.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCTCGCCAGGCCACGTCGCGGTTGGTGGTCGGAGAGGGCGAGGGGTCCCAGGGGGCTTCGGGGCCT GCAGCCACCATGCTCCGCTCCCTGCTGCTTCACTCCTTGAGGCTCTGCGCCCAGACCGCCTCGTGCCTC GTGCTCTTCCCGCGCTTCCTCGGCACGGCCTTCATGCTCTGGCTTCTCGATTTCTTGTGTATCCGCAAG CATTTCCTGGGCCGCCGCCGCCGGGGGCAGCCCGAGCCCGAAGTGGAGCTCAACAGTGAAGGCGAGGAG GTGCCTCCCGATGACCCGCCCATCTGCGTGTCCGACGACAACCGCCTGTGCACCCTGGCGTCGCTCAAG GCGGTGTGGCATGGCCAGAAGTTGGATTTCTTCAAGCAGGCGCACGAGGGCGGTCCGGCGCCCAACTCC GAGGTGGTTCTGCCCGACGGCTTCCAGAGCCAGCACATCCTCGACTACGCGCAAGGGAACCGCCCGCTG GTTCTCAATTTCGGCAGCTGCACCTGACCACCGTTCATGGCGCGCATGAGCGCCTTCCAGCGCCTGGTC ACTAAGTACCAGCGCGACGTCGACTTCCTCATCATCTACATCGAGGAAGCGCACCCCTCCGACGGCTGG GTCACCACGGACTCTCCCTACATCATCCCACAGCACCGGAGCCTGGAGGACCGGGTCAGCGCAGCGAGG GTACTGCAGCAAGGTGCACCCGGCTGCGCTCTGGTCCTCGACACCATGGCCAACTCCAGCAGCTCGGCC TATGGCGCCTACTTCGAGCGTCTCTATGTCATCCAGAGTGGCACTATTATGTACCAGGGCGGCCGTGGC CCCGACGGCTACCAGGTCTCTGAGCTGCGCACTTGGTTGGAACGCTATGATGAGCAACTGCACGGCGCT CGGCCCCGGAGGGTGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001362 |
| Insert Size | 915 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins. |
| OTI Annotation | This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001362.3 |
| RefSeq Size | 2120 bp |
| RefSeq ORF | 915 bp |
| Locus ID | 1735 |
| UniProt ID | P55073 |
| Protein Families | Druggable Genome |
| MW | 33.9 kDa |
| Gene Summary | The protein encoded by this intronless gene belongs to the iodothyronine deiodinase family. It catalyzes the inactivation of thyroid hormone by inner ring deiodination of the prohormone thyroxine (T4) and the bioactive hormone 3,3',5-triiodothyronine (T3) to inactive metabolites, 3,3',5'-triiodothyronine (RT3) and 3,3'-diiodothyronine (T2), respectively. This enzyme is highly expressed in pregnant uterus, placenta, fetal and neonatal tissues, and thought to prevent premature exposure of developing fetal tissues to adult levels of thyroid hormones. It regulates circulating fetal thyroid hormone concentrations, and thus plays a critical role in mammalian development. Knockout mice lacking this gene exhibit abnormalities related to development and reproduction, and increased activity of this enzyme in infants with hemangiomas causes severe hypothyroidism. This protein is a selenoprotein, containing the rare selenocysteine (Sec) amino acid at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. [provided by RefSeq, May 2016] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229149 | DIO3 (Myc-DDK-tagged)-Human deiodinase, iodothyronine, type III (DIO3), (Note, selenocysteine protein, internal stop codon, see reference data summary) |
CNY 3990.00 |
|
| RG229149 | DIO3 (GFP-tagged) - Human deiodinase, iodothyronine, type III (DIO3), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
CNY 4370.00 |
|
| SC122591 | DIO3 (untagged)-Human deiodinase, iodothyronine, type III (DIO3) (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
CNY 5808.00 |
