RFC5 (NM_181578) Human Untagged Clone

CAT#: SC327793

RFC5 (untagged)-Human replication factor C (activator 1) 5 36.5kDa (RFC5) transcript variant 2



  "NM_181578" in other vectors (6)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-RFC5 Antibody
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RFC36
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_181578, the custom clone sequence may differ by one or more nucleotides
ATGGTTGAAAAATACCGGCCACAGACCCTGAATGATCTCATTTCTCATCAGGACATTCTG
AGTACCATTCAGAAGTTTATCAATGAAGACCGACTGCCACACTTGCTTCTCTACGGTCCC
CCAGGGACAGGCAAGACATCTACCATCCTAGCCTGTGCGAAACAGCTATATAAAGACAAA
GAATTTGGCTCCATGGTCTTGGAGCTGAATGCTTCAGATGACCGAGGAATAGACATCATT
CGAGGACCGATCCTGAGCTTTGCTAGCACAAGGACAATATTTAAGAAAGGCTTTAAGCTA
GTGATCTTGGATGAAGCAGACGCCATGACTCAGGACGCCCAGAATGCCTTGAGAAGAGTA
ATTGAGAAATTCACAGAAAATACCAGATTCTGCCTCATCTGTAACTATCTGTCAAAGATC
ATCCCTGCCTTGCAGTCCCGCTGCACGAGGTTTCGGTTCGGTCCCCTGACTCCTGAACTC
ATGGTTCCCCGCCTGGAACATGTCGTGGAAGAAGAGAAAGTTGATATAAGTGAAGATGGA
ATGAAAGCACTAGTCACTCTTTCCAGTGGAGACATGCGTAGGGCTCTGAACATTTTGCAG
AGCACCAATATGGCCTTTGGGAAGGTGACAGAGGAGACTGTCTACACCTGCACCGGGCAC
CCGCTCAAGTCAGACATTGCCAACATCCTGGACTGGATGTTGAATCAAGATTTCACCACA
GCCTACAGAAATATTACAGAGTTGAAAACTCTGAAGGGGTTGGCACTGCATGATATCCTG
ACAGAGATACACTTGTTTGTGCATAGAGTTGACTTTCCATCTTCAGTTCGAATACATTTA
TTGACCAAAATGGCAGACATTGAGTACAGGCTTTCTGTTGGCACCAACGAGAAGATCCAG
CTGAGCTCCCTCATTGCTGCATTTCAAGTCACCAGAGACCTGATTGTTGCAGAGGCC
Restriction Sites Please inquire     
ACCN NM_181578
Insert Size 2486 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_181578.2, NP_853556.2
RefSeq Size 2486 bp
RefSeq ORF 960 bp
Locus ID 5985
UniProt ID P40937
Protein Families Stem cell - Pluripotency
Protein Pathways DNA replication, Mismatch repair, Nucleotide excision repair
Gene Summary This gene encodes the smallest subunit of the replication factor C complex, which consists of five distinct subunits (140, 40, 38, 37, and 36 kDa) and is required for DNA replication. This subunit interacts with the C-terminal region of proliferating cell nuclear antigen and is required to open and load proliferating cell nuclear antigen onto DNA during S phase. It is a member of the AAA+ (ATPases associated with various cellular activities) ATPase family and forms a core complex with the 38 and 40 kDa subunits that possesses DNA-dependent ATPase activity. A related pseudogene has been identified on chromosome 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region, and uses an alternate start codon, compared to variant 1. The resulting isoform (2) has a distinct and shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same isoform (2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...