THAP5 (NM_182529) Human Untagged Clone
CAT#: SC327804
THAP5 (untagged)-Human THAP domain containing 5 (THAP5) transcript variant 2
CNY 7220.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_182529, the custom clone sequence may differ by one or more nucleotides
ATGAAGCGAGATTCATGGGTTCCCAGTAAATACCAGTTTCTATGTAGTGACCATTTTACT CCTGACTCTCTTGACATCAGATGGGGTATTCGATATTTAAAACAAACTGCAGTTCCAACA ATATTTTCTTTGCCTGAAGACAATCAGGGAAAAGACCCTTCTAAAAAAAAATCCCAGAAG AAAAACTTGGAAGATGAGAAAGAAGTATGCCCAAAAGCCAAGTCAGAAGAATCATTTGTA TTAAATGAGACAAAGAAAAATATAGTTAACACAGATGTGCCCCATCAACATCCAGAATTA CTTCATTCATCTTCCTTGGTAAAGCCACCAGCTCCCAAAACAGGAAGTATACAAAATAAC ATGTTAACTCTTAATCTAGTTAAACAACATACTGGGAAACCAGAATCTACCTTGGAAACA TCAGTTAACCAAGATACAGGTAGAGGTGGTTTTCACACATGTTTTGAGAATCTAAATTCT ACAACTATTACTTTGACAACTTCAAATTCAGAAAGTATTCATCAATCTTTGGAAACTCAA GAAGTTCTTGAAGTAACTACCAGTCATCTTGCTAATCCAAACTTTACAAGTAATTCCATG GAAATAAAGTCAGCACAGGAAAATCCATTCTTATTCAGCACAATTAATCAAACAGTTGAA GAATTAAACACAAATAAAGAATCTGTTATTGCCATTTTTGTACCTGCTGAAAATTCTAAA CCCTCAGTTAATTCTTTTATATCTGCACAAAAAGAAACCACGGAAATGGAAGACACAGAC ATTGAAGACTCCTTGTATAAGGATGTAGACTATGGGACAGAAGTTTTACAAATCGAACAT TCTTACTGCAGACAAGATATAAATAAGGAACATCTTTGGCAGAAAGTCTCTAAGCTACAT TCAAAGATAACTCTTCTAGAGTTAAAAGAGCAACAAACTCTAGGTAGATTGAAGTCTTTG GAAGCTCTTATAAGGCAGCTAAAGCAGGAAAACTGGCTATCTGAAGAAAACGTCAAGATT ATAGAAAACCATTTTACAACATATGAAGTCACTATGATA |
| Restriction Sites | Please inquire |
| ACCN | NM_182529 |
| Insert Size | 3510 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_182529.2, NP_872335.2 |
| RefSeq Size | 3510 bp |
| RefSeq ORF | 3510 bp |
| Locus ID | 168451 |
| UniProt ID | Q7Z6K1 |
| Gene Summary | Has sequence-specific DNA-binding activity and can function as transcriptional repressor (in vitro) (PubMed:21110952). May be a regulator of cell cycle: THAP5 overexpression in human cell lines causes cell cycle arrest at G2/M phase (PubMed:19502560).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream start codon, compared to variant 1. It encodes isoform 2, which is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC208844 | THAP5 (Myc-DDK-tagged)-Human THAP domain containing 5 (THAP5), transcript variant 2 |
CNY 2400.00 |
|
| RC208844L3 | Lenti ORF clone of Human THAP domain containing 5 (THAP5), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC208844L4 | Lenti ORF clone of Human THAP domain containing 5 (THAP5), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RC229169 | THAP5 (Myc-DDK-tagged)-Human THAP domain containing 5 (THAP5), transcript variant 2 |
CNY 2400.00 |
|
| RC229169L1 | Lenti ORF clone of Human THAP domain containing 5 (THAP5), transcript variant 2, Myc-DDK-tagged |
CNY 4800.00 |
|
| RC229169L3 | Lenti ORF clone of Human THAP domain containing 5 (THAP5), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RG208844 | THAP5 (tGFP-tagged) - Human THAP domain containing 5 (THAP5), transcript variant 2 |
CNY 4000.00 |
|
| RG229169 | THAP5 (tGFP-tagged) - Human THAP domain containing 5 (THAP5), transcript variant 2 |
CNY 4370.00 |
|
| SC321867 | THAP5 (untagged)-Human THAP domain containing 5 (THAP5), transcript variant 2 |
CNY 2400.00 |
