PECI (ECI2) (NM_206836) Human Untagged Clone

CAT#: SC327823

ECI2 (untagged)-Human peroxisomal D3D2-enoyl-CoA isomerase (PECI) transcript variant 2



  "NM_206836" in other vectors (6)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
PECI mouse monoclonal antibody, clone OTI1C8 (formerly 1C8)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ACBD2; dJ1013A10.3; DRS-1; DRS1; HCA88; PECI
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_206836, the custom clone sequence may differ by one or more nucleotides
ATGGCGATGGCGTACTTGGCTTGGAGACTGGCGCGGCGTTCGTGTCCGAGTTCTCTGCAG
GTCACTAGTTTCCCGGTAGTTCAGCTGCACATGAATAGAACAGCAATGAGAGCCAGTCAG
AAGGACTTTGAAAATTCAATGAATCAAGTGAAACTCTTGAAAAAGGATCCAGGAAACGAA
GTGAAGCTAAAACTCTACGCGCTATATAAGCAGGCCACTGAAGGACCTTGTAACATGCCC
AAACCAGGTGTATTTGACTTGATCAACAAGGCCAAATGGGACGCATGGAATGCCCTTGGC
AGCCTGCCCAAGGAAGCTGCCAGGCAGAACTATGTGGATTTGGTGTCCAGTTTGAGTCCT
TCATTGGAATCCTCTAGTCAGGTGGAGCCTGGAACAGACAGGAAATCAACTGGGTTTGAA
ACTCTGGTGGTGACCTCCGAAGATGGCATCACAAAGATCATGTTCAACCGGCCCAAAAAG
AAAAATGCCATAAACACTGAGATGTATCATGAAATTATGCGTGCACTTAAAGCTGCCAGC
AAGGATGACTCAATCATCACTGTTTTAACAGGAAATGGTGACTATTACAGTAGTGGGAAT
GATCTGACTAACTTCACTGATATTCCCCCTGGTGGAGTAGAGGAGAAAGCTAAAAATAAT
GCCGTTTTACTGAGGGAATTTGTGGGCTGTTTTATAGATTTTCCTAAGCCTCTGATTGCA
GTGGTCAATGGTCCAGCTGTGGGCATCTCCGTCACCCTCCTTGGGCTATTCGATGCCGTG
TATGCATCTGACAGGGCAACATTTCATACACCATTTAGTCACCTAGGCCAAAGTCCGGAA
GGATGCTCCTCTTACACTTTTCCGAAGATAATGAGCCCAGCCAAGGCAACAGAGATGCTT
ATTTTTGGAAAGAAGTTAACAGCGGGAGAGGCATGTGCTCAAGGACTTGTTACTGAAGTT
TTCCCTGATAGCACTTTTCAGAAAGAAGTCTGGACCAGGCTGAAGGCATTTGCAAAGCTT
CCCCCAAATGCCTTGAGAATTTCAAAAGAGGTAATCAGGAAAAGAGAGAGAGAAAAACTA
CACGCTGTTAATGCTGAAGAATGCAATGTCCTTCAGGGAAGATGGCTATCAGATGAATGC
ACAAATGCTGTGGTGAACTTCTTATCCAGAAAATCAAAACTG
Restriction Sites Please inquire     
ACCN NM_206836
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_206836.2, NP_996667.2
RefSeq Size 1420 bp
RefSeq ORF 1185 bp
Locus ID 10455
UniProt ID O75521
Protein Pathways Fatty acid metabolism
Gene Summary This gene encodes a member of the hydratase/isomerase superfamily. The protein encoded is a key mitochondrial enzyme involved in beta-oxidation of unsaturated fatty acids. It catalyzes the transformation of 3-cis and 3-trans-enoyl-CoA esters arising during the stepwise degradation of cis-, mono-, and polyunsaturated fatty acids to the 2-trans-enoyl-CoA intermediates. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (2) uses an alternate upstream translational start codon and includes an alternate splice site in its 5' coding region, compared to variant 1. The encoded isoform (2) has a longer and distinct N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...