PSMC6 (NM_002806) Human Untagged Clone
CAT#: SC327828
PSMC6 (untagged)-Human proteasome (prosome macropain) 26S subunit ATPase 6 (PSMC6)
CNY 6560.00
Product images
                    
                CNY 6281.00
Specifications
| Product Data | |
| Type | Human Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | p42; RPT5; SUG2 | 
| Vector | pCMV6-Entry | 
| E. coli Selection | Kanamycin (25 ug/mL) | 
| Mammalian Cell Selection | Neomycin | 
| Sequence Data | 
                
                
                
                 >SC327828 representing NM_002806. 
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCATTCCCGGCATCCCCTATGAGAGACGGCTTCTCATCATGGCGGACCCTAGAGATAAGGCGCTT CAGGACTACCGCAAGAAGTTGCTTGAACACAAGGAGATCGACGGCCGTCTTAAGGAGTTAAGGGAACAA TTAAAAGAACTTACCAAGCAGTATGAAAAGTCTGAAAATGATCTGAAGGCCCTACAGAGTGTTGGGCAG ATCGTGGGTGAAGTGCTTAAACAGTTAACTGAAGAAAAATTCATTGTTAAAGCTACCAATGGACCAAGA TATGTTGTGGGTTGTCGTCGACAGCTTGACAAAAGTAAGCTGAAGCCAGGAACAAGAGTTGCTTTGGAT ATGACTACACTAACTATCATGAGATATTTGCCGAGAGAGGTGGATCCACTGGTTTATAACATGTCTCAT GAGGACCCTGGGAATGTTTCTTATTCTGAGATTGGAGGGCTATCAGAACAGATCCGGGAATTAAGAGAG GTGATAGAATTACCTCTTACAAACCCAGAGTTATTTCAGCGTGTAGGAATAATACCTCCAAAAGGCTGT TTGTTATATGGACCACCAGGTACGGGAAAAACACTCTTGGCACGAGCCGTTGCTAGCCAGCTGGACTGC AATTTCTTAAAGGTTGTATCTAGTTCTATTGTAGACAAGTACATTGGTGAAAGTGCTCGTTTGATCAGA GAAATGTTTAATTATGCTAGAGATCATCAACCATGCATCATTTTTATGGATGAAATAGATGCTATTGGT GGTCGTCGGTTTTCTGAGGGTACTTCAGCTGACAGAGAGATTCAGAGAACGTTAATGGAGTTACTGAAT CAAATGGATGGATTTGATACTCTGCATAGAGTTAAAATGATCATGGCTACAAACAGACCAGATACACTG GATCCTGCTTTGCTGCGTCCAGGAAGATTAGATAGAAAAATACATATTGATTTGCCAAATGAACAAGCA AGATTAGACATACTGAAAATCCATGCAGGTCCCATTACAAAGCATGGTGAAATAGATTATGAAGCAATT GTGAAGCTTTCGGATGGCTTTAATGGAGCAGATCTGAGAAATGTTTGTACTGAAGCAGGTATGTTCGCA ATTCGTGCTGATCATGATTTTGTAGTACAGGAAGACTTCATGAAAGCAGTCAGAAAAGTGGCTGATTCT AAGAAGCTGGAGTCTAAATTGGACTACAAACCTGTGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC  | 
        
| Restriction Sites | SgfI-MluI | 
| ACCN | NM_002806 | 
| Insert Size | 1212 bp | 
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). | 
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_002806.3 | 
| RefSeq Size | 1599 bp | 
| RefSeq ORF | 1212 bp | 
| Locus ID | 5706 | 
| UniProt ID | P62333 | 
| Domains | AAA, AAA | 
| Protein Pathways | Proteasome | 
| MW | 45.8 kDa | 
| Gene Summary | The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. Pseudogenes have been identified on chromosomes 8 and 12. [provided by RefSeq, Jul 2008] | 
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| RC202809 | PSMC6 (Myc-DDK-tagged)-Human proteasome (prosome, macropain) 26S subunit, ATPase, 6 (PSMC6) | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 3656.00  | 
                                            |
| RC202809L1 | Lenti ORF clone of Human proteasome (prosome, macropain) 26S subunit, ATPase, 6 (PSMC6), Myc-DDK-tagged | 
                                                     CNY 6056.00  | 
                                            |
| RC202809L2 | Lenti ORF clone of Human proteasome (prosome, macropain) 26S subunit, ATPase, 6 (PSMC6), mGFP tagged | 
                                                     CNY 5890.00  | 
                                            |
| RC202809L3 | Lenti ORF clone of Human proteasome (prosome, macropain) 26S subunit, ATPase, 6 (PSMC6), Myc-DDK-tagged | 
                                                     CNY 6056.00  | 
                                            |
| RC202809L4 | Lenti ORF clone of Human proteasome (prosome, macropain) 26S subunit, ATPase, 6 (PSMC6), mGFP tagged | 
                                                     CNY 5890.00  | 
                                            |
| RC229193 | PSMC6 (Myc-DDK-tagged)-Human proteasome (prosome, macropain) 26S subunit, ATPase, 6 (PSMC6) | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 3656.00  | 
                                            |
| RC229193L1 | Lenti ORF clone of Human proteasome (prosome, macropain) 26S subunit, ATPase, 6 (PSMC6), Myc-DDK-tagged | 
                                                     CNY 6056.00  | 
                                            |
| RC229193L3 | Lenti ORF clone of Human proteasome (prosome, macropain) 26S subunit, ATPase, 6 (PSMC6), Myc-DDK-tagged | 
                                                     CNY 5890.00  | 
                                            |
| RG202809 | PSMC6 (tGFP-tagged) - Human proteasome (prosome, macropain) 26S subunit, ATPase, 6 (PSMC6) | 
                                                     CNY 5256.00  | 
                                            |
| RG229193 | PSMC6 (tGFP-tagged) - Human proteasome (prosome, macropain) 26S subunit, ATPase, 6 (PSMC6) | 
                                                     CNY 4370.00  | 
                                            |
| SC118427 | PSMC6 (untagged)-Human proteasome (prosome, macropain) 26S subunit, ATPase, 6 (PSMC6) | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 3656.00  | 
                                            |
| SC320812 | PSMC6 (untagged)-Human proteasome (prosome, macropain) 26S subunit, ATPase, 6 (PSMC6) | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 3656.00  | 
                                            
